Skip to main content

Full text of "Le Scienze, n. 177"

See other formats


LE SCIENZE 



SCIENTI ne 
AMER1CW 



numero 177 
maggio 1983 
unno xvi 
volume xxx 



La Legge del mare 

Nel dicembre scorso 119 nazioni hanno firmato la Convenzione 
sulla Legge del mare. Gli Stati Uniti non hanno aderito, ma i 
programmi di sviluppo della nuova legge procederanno ugualmente 



di Elisabeth Mann Borgese 



Il 6 dicembre dello scorso anno i rap- 
presentanti di 1 19 nazioni, riuniti a 
Montego Bay in Giamaica. hanno 
firmato la Convenzione delle Nazioni 
Unite sulla Legge del mare. La cerimonia 
ha coronato oltre 10 anni di lavori della 
più numerosa e più lunga di tutte le confe- 
renze internazionali. La terza Conferenza 
delle Nazioni Unite sulla Legge del mare 
aveva impegnato ben 3000 delegati in 15 
sessioni per un totale di 585 giorni. Inizia- 
la nel caos e nello scontro di interessi 
politici ed economici opposti, la Confe- 
renza è riuscita, una bozza dopo l'altra, a 
redìgere una «costituzione per gli oceani» 
in 320 articoli (organizzati in 17 parti 
principali) e nove allegati tecnici. 

Per quanto sia possibile sintetizzare 
in una sola frase il succo di questa e- 
norme mole di lavoro, si può dire che la 
Convenzione sostituisce al tradizionale 
sistema del laissez faìre per quanto con- 
cerne la libertà dei mari un sistema di 
gestione completamente nuovo. In luogo 
dello sconfinato mare bidimensionale, la 
Convenzione si occupa di una risorsa tri- 
dimensionale circoscritta, le cui profondi- 
tà hanno lo stesso interesse economico 
della superficie. Essa pone il 40 per cento 
del mare e i fondali adiacenti alle coste dei 
continenti e delle isole sotto l'ammini- 
strazione degli stati titolari delle coste in 
questione. Riserva l'altro 60 per cento 
della superficie e le acque sottostanti alla 
tradizionale libertà dei mari, ma trasferi- 
sce le ricchezze dei fondali marini, pari al 
42 per cento della superficie terrestre, al 
«patrimonio comune del genere umano». 
La Convenzione assoggetta tale patrimo- 



nio alla gestione di un ente internazionale 
per i fondali marini, completamente nuo- 
vo, la International Seabed Authority. 
che ha la capacità di creare reddito, il 
potere di imporre lasse e una specie di 
predominio sulla tecnologia per lo sfrut- 
tamento dei mari. 

Proprio in opposizione alta Seabed 
Authority. gli Stali Uniti, e altre 15 na- 
zioni industrializzate hanno ritirato la 
loro adesione alla Convenzione. Queste 
nazioni peraltro hanno firmato il docu- 
mento finale (final act) della Conferenza. 
(La Turchia, invece, non ha aderito né 
all'una né all'altro.) Le nazioni che hanno 
firmato il documento finale, ma non la 
Convenzione, hanno la facoltà di interve- 
nire, in veste dì osservatori non parteci- 
panti, alle future riunioni degli enti creati 
dalla Convenzione. La firma della Con- 
venzione dà a questa forza di legge, a 
patto che venga ratificata da almeno 60 
nazioni. Una volta che la Convenzione 
avrà ottenuto tale ratifica, è prevedibile 
che anche i non firmatari si decideranno a 
firmare come partecipanti a pieno titolo. 

La Convenzione prevede un ordina- 
mento globale organico per la tutela del- 
l'ambiente marino, un nuovo regime per 
le ricerche scientìfiche sul mare e un si- 
stema esauriente per risolvere le verten- 
ze. Essa assicura libertà di navigazione e 
libero transito negli stretti che servono 
alla navigazione internazionale, appel- 
landosi al nuovo concetto legale di «pas- 
saggio di transito», un diritto che non può 
essere sospeso in nessuna circostanza. 
Aggiorna e codifica il diritto tradizionale. 
Definisce, infine, i diritti e le responsabili- 



tà degli stati e delle organizzazioni inter- 
nazionali nel promuovere e intensificare 
un nuovo ordine nei mari e negli oceani. 
La costituzione della nuova Legge del 
mare tocca tutti i problemi che la comuni- 
tà mondiale deve affrontare nella nostra 
epoca; cibo ed energia, corsa agli arma- 
menti, comunicazioni e «rivoluzione nel- 
l'informazione», scambi commerciali, 
polìtiche dei prodotti del suolo, gestione e 
conservazione delle risorse, integrazione 
regionale e quegli orientamenti della 
scienza e della tecnologia che sono alla 
base di molte di tali questioni. È come se 
tutti i problemi fluissero insieme nello 
spazio oceanico e quest'ultimo fosse di- 
ventato il nostro laboratorio per la co- 
struzione di un nuovo ordine mondiale. 
Un ordine che - si spera - si dimostri più 
razionale, più umano e più sensibile alle 
effettive necessità del mondo di quanto lo 
sia stato il vecchio ordine che si va disgre- 
gando nella fame e nella violenza. 

"pino al 1973, quando ebbe inizio la ter- 
-*- za Conferenza delle Nazioni Unite 
sulla Legge del mare, questa era sempre 
stata fatta da uno o due o, al massimo, una 
mezza dozzina di stati marinari. Nel corso 
dei secoli, o dei millenni, i mari del Vec- 
chio Mondo furono sottoposti prima al 
codice di navigazione di Hammurabì e poi 
al diritto marittimo rodiota. 11 Mediterra- 
neo, culla della civiltà occidentale, diven- 
tò limare nostrum di Roma. Nel 1493, la 
Spagna e il Portogallo si divisero fra loro 
lo spazio oceanico che si estendeva oltre lo 
Stretto di Gibilterra. Per la potenza marit- 
tima dell'Inghilterra del Seicento, John 



13 




L'adozione della Convenzione sulla Legge del mare è stata ripresa in questa l'olografia del quarlìcr 
generale delle Nazioni Unite a New York il 30 aprile dello scorso anno. Sopra i delegati c'è un 
tabellone elettronico che riporta il risultato della votazione: 130 nazioni favorevoli, 4 contrarie e 
17 astenute. Il n dieembre scorso, 114 di queste nazioni hanno firmalo a Monlego Bay, in 
Giamaica. la Convenzione, e 143 hanno firmato il documento finale della Conferenza sulla Legge 
del mare. Sottoscrivendo quest'ultimo, ma non la Convenzione, una nazione ha il diritto di 
intervenire come osservatore non > citante alle future riunioni della Commissione preparatoria. 



Selden propose la teoria del mure ctttu- 
surn, il mare chiuso «di proprietà» degli 
stati rivieraschi che, come ai loro tempi la 
Spagna e il Portogallo, avrebbero avuto il 
diritto di controllarlo e di esigere un pe- 
daggio dai navigatori di altre nazioni. 
Contro questa dottrina, il giurista olande- 
se Hugo Grotìus propose il concetto di 
mare libertini, il mare libero aperto ai na- 
vigatori di tutte le nazioni, ognuna delle 
quali avrebbe concesso lo stesso diritto 
alle altre. Nella realtà storica la libertà dei 
mari potè essere goduta soltanto da chi 
era in grado dì farla rispettare: in tutta la 
storia moderna solo un piccolo numero di 
paesi dell'Europa occidentale e dell'A- 
merica Settentrionale. 

Due drammatici sviluppi nelle vicende 
umane, concomitanti e spesso in conflitto 
fra loro, resero indispensabile la convoca- 
zione della terza Conferenza delle Nazio- 
ni Unite sulla Legge del mare. Il primo di 
essi è costituito dalla dimensione marit- 
tima della rivoluzione scientifico-indu- 
striale che sta faticosamente trasforman- 
do le società industrializzate e che sta in- 
cidendo profondamente sui rapporti fra 
queste società e quelle preindustrializza- 
te. La scoperta del fenomeno dell'espan- 
sione del fondo marino ha avuto la conse- 
guenza letteralmente sismica di porre 
come idea ordinatrice centrale in geologia 



la tettonica a zolle. Questa stessa scoperta 
ha implicazioni economiche dì vasta por- 
tata. Là dove, lungo gli assi di espansione, 
il fondo marino si sta spaccando, i metalli 
si sono separati selettivamente dal man- 
tello terrestre fino alla superficie. Si sa 
oggi che questo processo è responsabile 
della deposizione dei filoni di metalli non 
ferrosi fin qui estratti nelle miniere in roc- 
cia dura sparse nel mondo. Dalla stessa 
più approfondita conoscenza del fondo 
marino sì sa che non solo nel fondo ben- 
tonico. ma anche nelle piattaforme conti- 
nentali, esso contiene più petrolio e più 
gas dei trappi esistenti nella roccia conti- 
nentale (gran parte della quale, natural- 
mente, era anch'essa un tempo fondo 
marino). 

Nel frattempo, il rapido sviluppo tecno- 
logico dell'industria della pesca ha annul- 
lato il vecchio concetto secondo il quale le 
risorse ittiche dell'oceano sono inesauri- 
bili. Nel medesimo tempo, la presunta in- 
finità dell'oceano è stata sottoposta a 
dura prova dall'inquinamento dovuto al- 
l'urbanizzazione, all'industriai izzazione e 
alla crescita costante della popolazione. 

Così le premesse della vecchia Legge 
del mare si erosero e la legge incominciò a 
sgretolarsi. Gli Stati Uniti diedero l'avvio 
all'aumento delle rivendicazioni naziona- 
li sul mare e sulle sue risorse nel 1 945 con 



le Proclamations di Truman sulla piatta- 
forma continentale e la zona di pesca al- 
largata. Subito si accese una mischia per 
suddividere lo spazio oceanico, proprio 
come un secolo prima era stata suddivisa 
l'Africa. 

Mentre la Rivoluzione Industriale pe- 
netrava nei mari dall'emisfero settentrio- 
nale, nell'emisfero meridionale andava 
acquistando forza il secondo grande im- 
pulso che avrehbe poi dato forma alla 
nuova Legge del mare. Dagli imperi colo- 
niali creati dalle ex potenze marittime 
europee nacque tutta una serie di nuove 
nazioni sovrane. Alta prima Conferenza 
delle Nazioni Unite sulla Legge del mare, 
indetta nel 1958, o alla seconda, indetta 
nel 1960, avevano preso parte non più di 
70 nazioni. Nel 1973, quando si riunì la 
terza Conferenza, il numero dei membri 
delle Nazioni Unite era più che raddop- 
piato. All'Assemblea generale la maggio- 
ranza era passata alle nazioni povere del- 
l'Asia, dell'Africa e dell'America Latina, 
le quali erano decise a far sentire la pro- 
pria voce nelle deliberazioni della Confe- 
renza. Di lì a poco avrebbe preso consi- 
stenza la loro richiesta di un nuovo ordine 
economico internazionale. La nuova 
Legge del mare non solo avrebbe fatto 
parte di questo nuovo ordine, ma gli 
avrebbe fatto perfino da modello. 

La Convenzione sulla Legge del mare 
J dimostra chiaramente di essere stata 
plasmata dalle rivoluzioni parallele, ma 
spesso ìntersecantisi, che si sono avute 
nella tecnologia e nelle relazioni inter- 
nazionali. È stata la rivoluzione tecnolo- 
gica a stimolare dal Nord l'espansione 
della giurisdizione nazionale nello spazio 
oceanico, mentre è stata la rivoluzione 
avvenuta nelle relazioni internazionali a 
premere, dal Sud, perché si cercassero 
nuove, forti istituzioni internazionali. Le 
due rivoluzioni sono sempre in primo 
piano nei voluminosi verbali della lun- 
ga Conferenza, Peraltro la Convenzione 
stessa e i verbali della Conferenza rispec- 
chiano anche la presenza di numerose 
personalità, sia del Nord sia del Sud. abi- 
li, erudite e di grande statura politica: 
per citarne solo alcuni, Arvìd Pardo della 
Repubblica di Malta; Hamilton Shiriey 
Amerasinghe dello Sri Lanka, presidente 
della Conferenza fino alla sua prema- 
tura scomparsa, avvenuta nel 1981; Jens 
Evensen della Norvegia; Jorge Castane- 
da del Messico; S. P. Jagota dell'India e 
Louis Sohn degli Stati Uniti. Il loro ta- 
lento individuale ha interagito con le 
pressioni collettive esercitate sia dal 
Nord sia dal Sud per pilotare i lavori del- 
la Conferenza. 

Fu Pardo, ad esempio, a proporre in 
un memorabile discorso pronunciato nel 
1967 davanti al primo Comitato delle 
Nazioni Unite, che le ricchezze dei fon- 
dali marini fossero dichiarate patrimonio 
comune del genere umano. Né la libertà 
dei mari né la sovranità che a quel tempo 
veniva rivendicata sulle acque marine 
dagli stati costieri, egli disse, avrebbero 
potuto scacciare il triplice spettro del- 
l'inquinamento, dell'esaurimento della 



vita marina e della discordia internazio- 
nale. Soltanto la cooperazione interna- 
zionale avrebbe potuto salvaguardare la 
pace e le ricchezze dei mari, e la cosa 
sarebbe stata favorita dal fatto che. in 
essi, gli interessi costituiti non erano 
ancora saldamente radicati come lo era- 
no sulla terraferma. 

Fu nominato immediatamente un 
Comitato sugli usi pacifici dei fondali 
marini; nel 1970, fu approvata una 
Dichiarazione di princìpi, che includeva 
la tesi principale di Pardo e. nel 1972. 
la limitazione dei fondali marini a usi 
pacifici fu inclusa nel trattato che met- 
teva al bando le armi nucleari dal fon- 
do del mare. Nel 1972, il Comitato per 
i fondali marini, tuttora all'opera, chie- 
se la convocazione della terza Confe- 
renza delle Nazioni Unite sulla Legge 
del mare e incominciò a preparare l'or- 
dine dei lavori. 

Questo fu completato nel 1 973, allorché 
ebbero inizio i lavori della Conferenza sul- 
la Legge del mare. Organizzata in un Co- 
mitato generale, in tre principali comitati 
di lavoro e in una rete intricata di gruppi 
regionali, gruppi d'interesse, gruppi inca- 
ricati di condurre i negoziati, riunioni ple- 
narie formali e informali e un comitato 
addetto alla stesura delle bozze in sei lin- 
gue, questa conferenza è stata la più gran- 
de e la più complessa della storia. 

Il compito di delimitare gli spazi ocea- 
nici - le acque territoriali tradizionali e la 
zona contigua nonché le nuove zone eco- 
nomiche allargate e le piattaforme conti- 
nentali - fu assegnato ai potente secondo 
Comitato. Qui si dovettero conciliare gli 
interessi contrastanti di tre gruppi di na- 
zioni. Gli stati rivieraschi, naturalmente, 
cercavano di estendere il più possibile i 
limiti della loro giurisdizione e di assicu- 
rarsi il massimo dei diritti ottenìbili nella 
zona sotto tale giurisdizione. All'altra 
estremità dello spettro c'erano gli stati 
senza sbocchi sul mare, fra cui numerosi 
paesi africani, i più poveri fra i poveri. 
Essi non potevano rivendicare nessuna 
zona e rischiavano di perdere, nei mari 
che si sarebbero chiusi per loro, anche 
quei pochi diritti di cui forse godevano, 
soprattutto riguardo alla pesca. In mezzo 
stavano gli stati marinari, che condivide- 
vano alcuni degli interessi degli stati rivie- 
raschi ma, dipendendo pure dalla libertà 
dei mari per poter impiegare le proprie 
flotte in acque lontane, condividevano 
anche gli interessi degli stati senza sbocchi 
sul mare. Ognuno di questi gruppi era una 
complessa aggregazione di paesi svilup- 
pati e in via dì sviluppo sia a economia di 
mercato sia a pianificazione centrale. 

Non può esserci il benché minimo dub- 
bio che a trarre vantaggio dal l'espan- 
sione della giurisdizione nazionale siano 
stati di gran lunga i paesi industrializzati. 
soprattutto gli Stati Uniti, il Canada, 
l'Australia e il Sudafrica, oltre ad alcuni 
grandi paesi in via di sviluppo, fra cui 
l'India, il Brasile e il Messico. Gli articoli 
della Convenzione, promulgati dal se- 
condo Comitato, confermano il limite di 
12 migli,] per le acque territoriali oltre a 



una zona contigua di altre 1 2 miglia. Al di 
là di questi limiti essi accordano agli stati 
rivieraschi diritti sovrani sull'uso delle 
risorse naturali nella zona economica di 
200 miglia, recentemente sancita, e inol- 
tre molti altri diritti in merito a determi- 
nate attività, come per esempio la ricerca 
scientifica. Dove la piattaforma continen- 
tale si estende al di là della zona economi- 
ca di 200 miglia, con essa si estendono, 
però non oltre le 350 miglia, anche i diritti 
relativi alle risorse della piattaforma. 



Lo stato rivierasco non ha peraltro 
sovranità territoriale nella propria zona 
economica, così come l'ha sulla terra- 
ferma e sulle acque territoriali limitrofe. 
Questo nuovo tipo di sovranità funzio- 
nale potrebbe essere considerato la for- 
ma meno maligna di ingrandimento na- 
zionale. Sì tratta di un concetto nuovo e 
dinamico del diritto internazionale, che 
troverà indubbiamente nuove applica- 
zioni in futuro. 

La creazione della zona economica 




Depositi di minerali nelle profondità marine del Golfo di California sono vìsihili in quesla imma- 
gine ripresa con un sistema sonar a visione laterale. Le caratteristiche geomorfologiche che emergo- 
no dal fondo sono monticeli! e «pinnacoli», tipici delle zone di sorgenti idrotermali, che sì trovano in 
prossimità dei centri di espansione del fondo oceanico. In queste aree, dall'acqua calda emessa dal 
fondo precipitano solfuri ricchi di metalli. Le caratteristiche geo morfologiche sì elevano per 30 
metri al di sopra del fondo. La distanza fra quattro linee orizzontali è di 450 metri. 1-a fotografia è 
stata fornita da Fred N. Spiess e Peter F. Lonsdale di-Ila Scripps InsVìhitìon of Oceanography. 



14 



15 




Vari «piani d'azione» sono già in vigore o in preparazione nell'arabi- 
to dell'I nvironmenl Progrannne delle Nazioni Unite, t piani in vigo- 
re si riferiscono al Mediterraneo (5), al Mar Rosso e al Golfo di 
Aden (6) e alla kunuil Action Pian Kcj-inn (N); tinelli in prepara- 



zione, ai Carsi bi (1), al Pacifico sudorientale (2), all'Atlantico sud- 
occidentale (3), all'Africa occidentale (4), all'Africa orientale (7), ai 
mari dell'Asia orientale (9) e al Pacifico sud occidentale (IO). La 
proiezione cartografica è la stessa della carlina alle pagine 18 e 19. 



risponde anche alla necessita di gestione 
dell'ambiente marittimo. Essa costitui- 
sce un incentivo di carattere economico 
all'azione delle singole nazioni a questo 
riguardo, ma non soddisfa assolutamen- 
te la necessità in questione, perché né 
l'inquinamento né i pesci rispettano i 
confini nazionali. 

Dal lato negativo, il concetto di zona 
economica è stato definito il più grande 
arraffare territoriale della storia. L'e- 
spansione della giurisdizione nazionale 
nei mari accresce certamente la disugua- 
glianza fra le nazioni. Se sì sperava che la 
Conferenza ponesse limiti chiari e inequi- 
vocabili alla giurisdizione nazionale, bi- 
sogna dire che essa è venuta meno anche 
da questo punto di vista, Cosi come ven- 
gono definiti, i limiti sono elastici, con 
scappatoie che permetteranno di avanza- 
re ulteriori rivendicazioni in qualsiasi 
momento. E facile prevedere che la sco- 
perta di qualsiasi risorsa di notevole enti- 
tà in un punto qualsiasi dello spazio ocea- 
nico porterà a una rivendicazione da par- 
te dello stato insulare o rivierasco più vi- 
cino, nonostante le solenni dichiarazioni 
di non appropriabilità da parte di qualsia- 
si stato o persona (come potrebbe essere. 
per esempio, una grande società per azio- 
ni) de! patrimonio comune del genere 
umano «oltre i limiti della giurisdizione 
nazionale». 

Nondimeno, si può sperare che futuri 
sviluppi portino a ovviare a tutti t punti 
deboli e a mitigare le ingiustizie relative a 
questa parte della Convenzione. Con tut- 
ta probabilità ciò avverrà attraverso un 
progresso nella cooperazione regionale e 
il rafforzamento delle organizzazioni in- 
ternazionali. Comesi vedrà. c'è ragione di 
attendersi una certa forma di spartizione 
dei benefici economici, derivanti dallo 
sfruttamento della zona economica. 



Nel primo Comitato, a cui era stato 
assegnato il compito di stabilire il regime 
internazionale per la gestione del patri- 
monio comune del genere umano, gli 
schieramenti politici erano un po' diver- 
si, in quanto t'agente polarizzatore era 
chiaramente la divergenza di interessi fra 
le nazioni industrializzate del Nord e 
quelle in via di sviluppo del Sud. Il Sud 
sosteneva che l'adozione, avvenuta nel 
1970, della Dichiarazione di princìpi da 
parte dell'Assemblea generale delle Na- 
zioni Unite aveva dato al patrimonio 
comune del genere umano la sanzione 
del diritto internazionale. A suo modo di 
vedere, il compito del primo Comitato 
era quello di creare un forte ente per i 
fondali marini. la Seabed Authority. con 
ampie funzioni e vasti poteri. Tale en- 
ti: avrebbe avuto un braccio operativo, 
l'Enterprisc, che si sarebbe occupato di- 
rettamente delle ricerche e dello sfrut- 
tamento del patrimonio comune per con- 
to di tutto il genere umano e avrebbe 
potuto costringere le società minerarie a 
vendergli la tecnologia necessaria per 
quella funzione. Il Nord reagì a questa 
proposta proponendo a sua volta un ente 
autorizzato a concedere licenze e a ri- 
scuotere una piccola tassa, o royalty, sul- 
lo sfruttamento del patrimonio comune, 
che per il resto poteva essere utilizzato 
dal Nord a suo piacimento. 

Il compromesso che risolse questa con- 
troversia fu lungo e difficile da rag- 
giungere. Il Nord, tranquillo net suo 
possesso della tecnologia e dei capitali 
necessari, definì privo di senso pratico 
il sistema dell'Enterprise concepito dal 
Sud. D'altra parte l'ente autorizzato a 
concedere licenze, che veniva proposto 
dal Nord, era inaccettabile per la mag- 
gior parte delle nazioni riunite alla Con- 



ferenza, le quali lo consideravano una 
violazione del principio del patrimonio 
comune del genere umano. Il compro- 
messo proposto da Henry Kissinger uni- 
va in un «sistema parallelo» i'Entcrprise 
privo di senso pratico e l'inaccettabile 
ente autorizzato a concedere licenze. 
Per una sorta di incantesimo aritmeti- 
co, questa combinazione avrebbe dovu- 
to offrire una soluzione pratica e nel 
contempo accettabile! 

Nel corso delle tediose trattative per 
giungere a questo compromesso, il testo 
che definiva il sistema parallelo divenne 
sempre più astruso e lontano dalla realtà. 
Facendo leva sul timore di una mancata 
ratifica da parte del Senato degli Stati 
Uniti, il negoziatore americano Leigh 
Ratiner riuscì a far dichiarare esplicita- 
mente in anticipo ogni particolare ammi- 
nistrativo e finanziario e a fargli prendere 
forma in articoli che non si sarebbero 
potuti modificare per 25 anni - e questo 
per un'industria che non esisteva ancora e 
il cui futuro era dichiaratamente incerto. 
A questo punto il Sud ebbe qualche ri- 
pensamento sulla desiderabilità di sfrut- 
tare il patrimonio comune del genere 
umano, 11 calo dei prezzi dei prodotti de! 
suolo privò i paesi in via di sviluppo espor- 
tatori di risorse di una nuova fonte dì 
concorrenza per i loro minerali. Contro 
l'opposizione del Nord (a eccezione del 
Canada), questi paesi si sentirono più 
propensi a limitare la produzione dei fon- 
dali marini che non a gestirla. 

Altri sviluppi hanno contribuito a ri- 
durre ancora di più il valore del patrimo- 
nio comune del genere umano, soprattut- 
to dei noduli di manganese. Il Messico e il 
Cile hanno trovato ricchi giacimenti di 
noduli nelle proprie zone economiche, la 
Francia ha dei noduli nelle acque poline- 
siane e gli Stati Uniti possono rivendicare. 




A ALLA NAVE 



POMPA 
AD ARIA 
COMPRESSA 



KJ 



TRAMOGGIA 



CONGEGNO DI 
ALIMENTAZIONE 



COLONNA 
DI TUBI 



BLOCCO 
GALLEGGIANTE 




ELEMENTO 
DI RACCORDO 



VEICOLO DA MINIERA 




ELEMENTO ELICOIDALE 



Sono diversi i sistemi con cui i noduli di manganese, distribuiti su vaste 
aree del fondo oceanico, potrebbero essere raccolti. Il sistema illustra- 
to è stato ideato da Conrad G. Welling e dai suoi colleghi della Ocean 
Minemls Company. ] noduli contengono tipicamente il 25 per cento di 
manganese, I' 1,5 per cento di nichel, 1*1,2 per cento di rame e to 0.2 per 



cento di cobalto. In questo sistema un veicolo da miniera (in basso a 
destra) viene spostato sul fondo da due grandi supporti elicoidali. I no- 
duli soni) raccolti da un rastrello li nastro continuo, frantumati e pompati 
sotto forma di impasto liquido in un «elemento di raccordo» (in allo a 
destra), appeso a una colonna dì tubi che fa capo alla nave di superficie. 



16 



® 



17 



0* 20* 40* 60" Bff 100" 



100* 120* 140" W 1«C l*(r 1OT toc 



ioo" so- so- w ao- 0* 




IO" 30- SO" 70° 90- 110" 130" 



150- 170* 150- 130* no- «r w 



70* SO* 30* 10- 



In questa carlina, che si basa su una precedenti.' cartina compilala da 
F. Webster McBryde della Transemantics, Inc., sunti raccolte lo riven- 
dicazioni marittime delle varie nazioni. Le aree in azzurro sono le /une 
di pesca, in cui sono rivendicati i diritti esclusivi di pesca. Le aree in 



verde sono le ione economiche, in cui vengono rivendicati non solo i 
diritti di pesca, ma anche i diritti sovrani su tulle le risorse e la giurisdi- 
zione sulla ricerca e sull'inquinamento marino. Le aree in arancione 
sono «acque terriloriali», in cui vengono rivendicati pieni diritti sovrani 



fatto salvo il diritto di «passaggio innocente» (transito senza importan- 
za militare, economica e scientifica!. Queste rivendicazioni, che riguar- 
dano complessivamente circa il 40 per cento degli oceani, sono ricono- 
sciute dalla Convenzione Milla Legge del mare. Il restante 611 per cento 



è riservalo alla tradizionale libertà dei mari, e te risorse in esso presenti 
sono trasferite con atto legislativo al «patrimonio comune del genere 
umano». La proiezione cartografica È slata ideata da McBryde per 
evitare la distorsione sia delle zone di terraferma sia di quelle di mare. 



al largo delle Hawaii e di altre isole del 
Pacifico, centinaia di migliaia di miglia 
quadrate di fondale oceanico in cui è pro- 
babile che vi siano dei noduli sfruttabili 
sul piano commerciale. I noduli stessi 
hanno perso gran parte della loro attratti- 
va a causa del rinvenimento di depositi di 
solfuri polimetallici, contenenti rame e 
altri metalli in concentrazioni molto più 
elevate, avvenuto per la prima volta in 
bocche vulcaniche nel rift del Pacifico vi- 
cino alle isole Galapagos e al largo delle 
coste dell'Oregon e dello stato di Wa- 
shington. Depositi analoghi sì trovano 
sicuramente in qualsiasi altro punto delle 
40 000 miglia della dorsale tettonica sot- 
tomarina, che si estende tutt 'intorno al 
mondo. 



Ciò nonostante, la creazione della In- 
ternational Seabed Auihoriiy con il con- 
senso praticamente dell'intera comunità 
mondiale (fra cui vanno contati anche gli 
Stati Uniti, i quali hanno dato il loro con- 
senso alla Conferenza, e sono sicura che 
continueranno a darlo) deve essere con- 
siderata un grande progresso nelle rela- 
zioni internazionali. Si tratta infatti, in- 
nanzitutto, di un'istituzione intemaziona- 
le senza precedenti, in quanto ha ti potere 
di emanare ordinamenti e di agire sulla 
base del nuovo principio del patrimonio 
comune del genere umano. In secondo 
luogo, si tratta di un primo tentativo di 
politica globale della produzione, che 
tenga debitamente conto della conserva- 
zione dell'ambiente. In terzo luogo, è 



un'apertura alla cooperazione industriale 
fra Nord e Sud, basata non sull'assistenza, 
ma sulla compartecipazione. Cinquan- 
tanni fa la Comunità economica europea 
era il sogno di alcuni «federalisti». L'In- 
temational Seabed Authority, un sogno 
utopistico di 20 anni or sono, è ora una 
realtà del diritto internazionale. Qualcosa 
si sta muovendo. 

Ta definizione di un nuovo regime per 
*—' la ricerca scientifica marina, per la 
tutela e la conservazione dell'ambiente 
marino e per l'incoraggiamento del tra- 
sferimento di tecnologia è stato il compito 
del terzo Comitato, il quale ha portato a 
termine la propria opera prima degli altri 
in quanto, nelle sue deliberazioni, srè 



avuta una polarizzazione polìtica meno 
accentuata. 

La libertà di svolgere ricerche scientifi- 
che, implicita net concetto di libertà dei 
mari, è chiaramente limitata nelle acque 
oceaniche dalla giurisdizione nazionale. 
Va notato peraltro che, nell'ambito del 
«regime di consenso» previsto dalla Con- 
venzione, uno stato rivierasco dovrebbe 
dare il proprio benestare ai cittadini di 
altri paesi che vogliano svolgere ricerche 
nelle sue acque. (Gli scienziati americani, 
che sì preoccupavano per i ritardi buro- 
cratici nell'ottenere il consenso degli stali 
rivieraschi, farebbero bene ora a preoc- 
cuparsi della mancata adesione del loro 
paese alla Convenzione, che può impedi- 
re loro addirittura dì chiedere il benesta- 



re, e di ottenerlo.) 11 regime del consenso 
dovrebbe avere l'effetto di incoraggiare la 
cooperazione bilaterale nelle iniziative di 
ricerca, adattandole non solo agli interes- 
si dei ricercatori, ma anche a quelli dello 
stato rivierasco. Più di qualsiasi altro 
strumento legale del passato, la Conven- 
zione incoraggia l'internazionalizzazione 
della ricerca marina, rendendo ripetuta- 
mente obbligatoria la cooperazione e 
chiedendo l'intervento delle «competenti 
organizzazioni internazionali». Si ritiene 
che eventuali progetti intrapresi sotto il 
patrocinio di tali organizzazioni debbano 
ricevere il consenso dello stato rivierasco, 
a patto che quest'ultimo vi partecipi e non 
si sia dichiarato contrario al progetto stes- 
so nell'ambito dell'organizzazione. 



Le misure per ta tutela e la conserva- 
zione dell'ambiente marino previste dalla 
Convenzione riguardano l'inquinamento 
provocato dai natanti, l'inquinamento 
prodotto dallo sfruttamento minerario 
dei fondali marini e dalla produzione di 
petrolio e l'inquinamento dovuto a fonti 
situate sulla terraferma e nell'atmosfera. 
Questa struttura organica per un codice 
internazionale dì leggi prevede perfino la 
possibile modificazione dell'ambiente 
con l'introduzione di specie esotiche me- 
diante acquicoltura o l'applicazione di 
nuove tecnologie. Gli stati sono ritenuti 
responsabili dei danni provocati non solo 
in acque sotto la giurisdizione di altri 
stali, ma anche in alto mare. Le organiz- 
zazioni competenti, con particolare rife- 



18 



19 



rimerito alla Intergovernmental Maritime 
Organizatìon e all'Environment Pro- 
gramme delle Nazioni Unite, sono tenute 
a proseguire i lavori in cui sono già impe- 
gnate e, in tal modo, vedono rafforzata, la 
propria autorità. 

Anzi, attraverso il suo programma re- 
gionale per i mari, l'Environment Pro- 
gramme delle Nazioni Unite ha già dato 
inizio alla conversione della legge «mite» 
della Convenzione in una legge «dura», 
che si possa imporre. Oggi vi sono 1 1 
programmi del genere, che impegnano 
circa 1 10 stati e un gran numero di enti 
intergovernativi e non governativi (si 
veda l'illustrazione a pagina Ì6). Le 
nazioni partecipanti si stanno tassando 
per coprire il costo di ripulitura dei mari 
e di prevenzione di ogni ulteriore inqui- 
namento. Mentre la Conferenza era 
ancora in corso di svolgimento, l'Envì- 
ronrnent Programme delle Nazioni Uni- 
te metteva già in vigore le norme e i cri- 
teri universali per il controllo dell'inqui- 
namento, promulgati nella bozza della 
Convenzione. 

Di fronte all'indifferenza, più che alla 
resistenza, del Nord, i paesi in via di svi- 
luppo hanno fatto propri gli articoli della 
Convenzione, relativi al trasferimento 
della tecnologia marina. Essi si sono spin- 
ti fin dove hanno potuto, ma il risultato è 
stato in realtà una legge «mite». Il trasfe- 
rimento di tecnologia rappresenta un 
compito complesso dal punto di vista tec- 
nico, sociale, politico ed educativo. Ci si 
può benissimo chiedere se sarà mai possi- 
bile attuarlo in via legislativa. La legge fa 
quello che può per porre obiettivi e speci- 
ficare metodi di cooperazione; il resto 
dipende dalla storia; una storia che si sta 
già delineando. Nei paesi industrializzati, 
l'antiquato sistema dei brevetti non ha 
molta corrispondenza con la realtà della 
concorrenza tecnologica. La proprietà 
intellettuale deve proprio trovare il suo 
posto naturale nel patrimonio comune del 
genere umano. 

La Convenzione dà un importante con- 
J tributo allo sviluppo di un sistema 
obbligatorio per comporre le controver- 
sie e quindi al mantenimento della pace. 
Essa stabilisce anzi il sistema globale più 
organico e più vincolante che sia mai stato 
concepito. Nel Tribunale internazionale 
della Legge del mare è stata istituita una 
nuova corte suprema, che avrà la propria 
sede, giustamente, nella città anseatica di 
Amburgo, In una delle sue sessioni spe- 
ciali, che si occupa appunto dei fondali 
marini, troveranno ascolto sia gli enti sia 
le singole persone. Purtroppo (ma la cosa 
era inevitabile) il sistema offre anche va- 
rie scappatoie: gli stati possono chiedere 
di essere esentati dalle procedure obbli- 
gatorie per la soluzione delle vertenze, 
soprattutto per quel che riguarda le que- 
stioni più delicate, come per esempio la 
delimitazione dei confini delle acque ter- 
ritoriali o le questioni relative agli usi mi- 
litari del mare. 

Sotto questo aspetto, così come da mol- 
ti altri punti di vista a cui si è fatto cenno, 
la Convenzione è un documento ambi- 



guo. La Legge del mare non ha comunque 
un'esistenza autonoma: essa deve essere 
considerata l'espressione dell'ordine e del 
disordine del nostro tempo, nazionale ol- 
tre che. internazionale. Se le attuali ten- 
denze continueranno in altri settori delle 
relazioni internazionali, gli stati sfrutte- 
ranno le scappatoie, le imperfezioni e le 
contraddizioni della Convenzione per 
saccheggiare e inquinare il mare, sfrut- 
tarne fino all'esaurimento le risorse vive e 
schierare le proprie armi nelle sue acque 
profonde. Se, invece, decideranno di av- 
viare seri negoziati di pace e di sviluppo 
globale equilibrato, essi si accorgeranno 
che la Convenzione offre un fondamento 
per costruire un mondo migliore. 

Il mare è destinato a svolgere una pane 
di sempre maggiore rilievo nell'economia 
mondiale. A giudicare dai primi lievi passi 
nel campo dell'acquicoltura, la tradizio- 
nale tecnologia della caccia e della raccol- 
ta lascerà il campo alla coltivazione di 
piante acquatiche e all'allevamento di 
animali acquatici. Il fondo marino soddi- 
sferà la domanda di metalli molto tempo 
dopo che l'assottigliamento delle riserve 
di minerali sulla terraferma avrà esaurito 
tutte le possibili risorse della tecnologia. 
Entro la fine del secolo, il fondo del mare 
fornirà più di metà del petrolio mondiale 
e l'oceano conterrà energia di riserva nel- 
le maree, nelle onde e nelle correnti, nei 
gradienti termici e salini, nella biomassa 
e, non meno importanti in prospettiva, 
nei rarefatti, ma abbondanti atomi di deu- 
terio delle molecole d'acqua. 

La crescente importanza economica 
del mare, lo inserirà più direttamente nel- 
la vita politica delle nazioni e delta comu- 
nità internazionale. Alcuni paesi stanno 
creando dei dipartimenti per lo sviluppo 
dei mari, dei ministeri degli affari marini e 
altre cose del genere per adempiere a 
nuove funzioni di gestione delle acque del 
mare, E stanno aggiornando il proprio 
diritto marittimo ed estendendo l'appli- 
cazione della legge ad aree e attività fin 
qui non coperte dal punto di vista legale. 
Armonizzando le proprie norme e le pro- 
prie istituzioni con la Convenzione sulla 
Legge del mare, esse stanno interioriz- 
zando e mettendo in pratica le disposizio- 
ni della Convenzione. 

Le competenti organizzazioni interna- 
zionali tanto spesso evocate nella Con- 
venzione - l'Intergovernmental Maritime 
Organizatìon, la Food and Agriculture 
Organizatìon delle Nazioni Unite, l'in- 
tergovernmental Oceanographic Com- 
mission dell'UNESCO e l'Environment 
Programme delle Nazioni Unite - si sono 
già messe al lavoro. Per quel che riguarda 
soprattutto i paesi rivieraschi in via di svi- 
luppo, questi organismi hanno il compito 
di aiutare a dare forma alla legislazione 
nazionale, a migliorare la gestione delle 
risorse vive nelle loro zone economiche 
allargate, a tracciare delle rotte di naviga- 
zione e a creare degli schemi per il con- 
trollo del traffico, a istituire dei centri 
regionali per il progresso della scienza e 
della tecnologia dei mari e ad arbitrare le 
vertenze. 

Anche se la cosa appare paradossale. 



l'estensione della giurisdizione nazionale 
al mare non diminuisce la necessità della 
cooperazìone internazionale, ma anzi 
l'aumenta enormemente. Non ci potrà 
mai essere cooperazione internazionale 
senza nazioni ben organizzate. Nella real- 
tà tecnologica ed economica del giorno 
d'oggi nessun paese potrà mai rimanere 
sano sul piano economico senza una forte 
cooperazione internazionale. 

Te reti mondiali del programma regiona- 
*-' le per i mari stanno aprendo la strada 
a nuovi modi di cooperazìone internazio- 
nale. Gli interessi che ogni nazione ha nel 
mare sono talmente importanti che nem- 
meno in tempo di guerra turchi e greci, 
israeliani e arabi, iracheni e iraniani han- 
no interrotto la cooperazione nei rispetti- 
vi programmi. Il successo di un program- 
ma regionale per i mari nell'oceano In- 
diano potrebbe dare impulso in quella 
regione al concetto di «Mare della pace», 
che è stato adottato e reiterato dalle Na- 
zioni Unite, ma che non è mai stato rispet- 
tato dalle superpotenze. Nel Mediterra- 
neo lo sviluppo di un meccanismo per il 
reperimento dei fondi necessari per fi- 
nanziare un analogo programma potreb- 
be forse far rivivere un'idea avanzata per 
la prima volta nel 1972 da Malta e dal 
Messico nelle deliberazioni del Comitato 
per i fondali marini, cioè l'idea di imporre 
alle nazioni una tassa sull'uso del mare, 
sui proventi del petrolio estratto in mare 
aperto, sulle zone di pesca commerciali e 
sul commercio marittimo. 

La firma della Convenzione a Montego 
Bay ha fatto entrare in funzione a parti- 
re dal mese di marzo una nuova organiz- 
zazione, la Commissione preparatoria, 
incaricata di redigere le norme e le regole 
per rinternational Seabed Authority. 
l'ente internazionale per i fondali marini, 
e un ordine del giorno provvisorio per la 
prima sessione dei consigli di amministra- 
zione di quest'ultima. La convocazione di 
questa prima sessione deve però attende- 
re la ratifica della Convenzione. Fino a 
quel momento, che non si sa quanto sia 
vicino o lontano, la Conferenza ha confe- 
rito alla Commissione preparatoria alcuni 
dei poteri dell'ente stesso. Fra i notevoli 
poteri, funzioni e responsabilità di cui 
dispone, la Commissione deve esaminare 
le domande di esplorazione di un sito fat- 
te da «investitori pionieristici», verificare 
i dati delle prospezioni, scegliere i siti da 
riservare al futuro ente per i fondali e al 
suo braccio operativo, l'Enterprise, e 
negoziare accordi per il trasferimento di 
tecnologia all'ente stesso e per l'adde- 
stramento di personale proveniente dai 
paesi in via di sviluppo. In breve, la 
Commissione preparatoria ha notevoli 
possibilità operative. Essa offre in certo 
qual modo un regime interinale per l'e- 
splorazione, la ricerca e lo sviluppo della 
tecnologia estrattiva dei mari, ed è pro- 
babile che alcune attività della Seabed 
Authority stessa si limiteranno, sino alla 
fine di questo secolo, all'esplorazione, 
alla ricerca e allo sviluppo. 

Una volta acquisita la tecnologia neces- 
saria - forse attraverso una società a capi- 



tale misto o a vari tipi di comparteci- 
pazione con compagnie minerarie - la 
Commissione potrebbe applicarla non 
solo per compiere ricerche esplorative di 
noduli nell'arca internazionale, ma anche 
per aiutare i paesi in via di sviluppo, che 
chiedono formalmente questo tipo di as- 
sistenza, a svolgere ricerche minerarie e a 
sviluppare le risorse delle loro zone eco- 
nomiche nazionali. Non c'è nulla nella 
Convenzione che impedisca sia alla Sea- 
bed Authority. sia alla Commissione pre- 
paratoria prima di essa, di rendere questi 
servizi utili e necessari, a condizione che 
essi siano richiesti da uno stato rivierasco. 

Un altro servizio utile sul piano imme- 
diato, che la Commissione potrebbe ren- 
dere, sarebbe quello di creare dei parchi 
marini, zone di cui è «disapprovato lo 
sfruttamento», e di riservarli a scopi 
scientifici. Il primo parco di questo genere 
potrebbe fare da cordone intorno alle 
bocche termali sottomarine delle isole 
Galapagos e alle strane colonie di crosta- 
cei e di giganteschi organismi tubiformi 
alimentati in quella zona dalla chemosin- 
tesi batterica che produce zolfo anziché 
ossigeno, come nella più familiare e onni- 
presente fotosintesi (si veda l'articolo La 
eresia della Dorsale pacìfico-orientale di 
Ken C, Macdonald e Bruce P. Luyendyk 
in «Le Scienze», n. 155. luglio 1981). 

Un terzo servizio utile nell'immediato 
riguarderebbe il controllo degli arma- 
menti e il disarmo. 11 trattato del 1972. 
che mette al bando le armi nucleari dal 
fondo del mare, non provvedeva alle 
ispezioni intese a verificare l'osservanza 
delle sue norme. L'ispezione veniva la- 
sciata per inadempienza alle superpoten- 
ze. La maggior parte dei paesi voleva in- 
ternazionalizzare il controllo e la sorve- 
glianza, ma fu frustrata dalla mancanza di 
un'organizzazione internazionale compe- 
tente. La Commissione preparatoria e la 
Seabed Authority potrebbero colmare 
questo vuoto. 

Nei 1987, quando si dovrà procedere 
alla revisione de! trattato per il di- 
sarmo del fondo marino, può darsi che la 
Commissione avrà acquisito il necessario 
know-how; le stesse tecnologie acustiche, 
sismiche, magnetiche ed elettroniche 
impiegate nell'esplorazione delle risorse 
potranno essere destinate al compito del- 
l'ispezione. Un emendamento al trattato, 
che sarebbe accolto favorevolmente da 
una grande maggioranza dei firmatari, 
potrebbe affidare questo compito alla 
Commissione preparatoria o alla Seabed 
Authority stessa se. a quell'epoca, la 
Convenzione sarà stata ratificata. 

La firma della Convenzione a Montego 
Bay da parte della stragrande maggioran- 
za della comunità intemazionale apre così 
una nuova fase nella costruzione di un 
ordine internazionale. Essa offre nuovi 
strumenti per accrescere lo sviluppo eco- 
nomico, promuovere il disarmo, assicura- 
re la tutela dell'ambiente e creare nuove 
forme di cooperazione scientifica e indu- 
striale fra Nord e Sud. Tutte queste possi- 
bilità non esisterebbero senza la nuova 
Legge del mare. 



/ raccoglitori 
per il 1983 



r 

volumi 



Quesiì raccoglitori corrispondono ai v< 
XXX e XXXI della rivista, e rispettivamente 
ai fascicoli da gennaio (n. 173) a giugno (n. 178) 
e da luglio (n. 179) a dicembre (n. 184). 

Sono ancora disponìbili i raccoglitori 
dal Voi XXII al XXIX e dei raccoglitori 
non numerati appositamente approntati per 
sostituire i raccoglitori esauriti. 

I raccoglitori si possono richiedere 
direttamente all'editore 

usando l'apposita cartolina allegata alla rivista e 
unendo il relativo importo; gli ordini infatti 
vengono evasi solo a pagamento avvenuto. 

I raccoglitori si trovano anche presso i 
seguenti punti di vendita: 

BOLOGNA 

Libreria Paroline 

Via V. Bassi 14 

FIRENZE 

Libreria Marzocco 

Via de' Martelli 22IR 

GENOVA 

Libreria Intem. Di Stefano 

ViaR.Ceccardi40IR 

MILANO 

Le Scienze S.p. A. 

Via del Lauro 14 

TORINO 

Libreria Zanaboni 

Cso Vittorio Emanuele 41 

NAPOLI 

Libreria Guida A. 

Via Fort' Alba 20121 

PADOVA 

Libreria Cortina 

Via F. Manolo 4 

PALERMO 

Libreria Dante 

Quattro Canti di Città 

ROMA 

Claudio Aranci 

Viale Europa 319 (EUR) 

Ogni 
raccoglitore 
L. 3.600 








&%é£^%£ 



'"a**? 



20 



21 



La scrittura della civiltà 
di Harappa 

Una fra le quattro più antiche civiltà del mondo ha una scrittura 
che ha resistito da sempre a ogni tentativo di decifrazione. Oggi, sulla 
base della documentazione archeologica, si comincia a interpretarla 

di Walter A. Fairservis, Jr. 



Ie civiltà più antiche sono quelle dì 
Sumer, dell'Egitto, della Cina e 
^J della valle dell'Indo, nella parte 
nordoccidentale del subcontinente occu- 
pato oggi dall'India, dal Pakistan e dal 
Bangladesh, Gli scritti delle tre civiltà 
nominate per prime possono essere letti, 
mentre le iscrizioni della civiltà della valle 
dell'Indo rimangono in gran parte enig- 
matiche. Quanto sappiamo di questa ci- 
viltà deriva perciò esclusivamente dagli 
oggetti materiali riportati in luce dagli 
archeologi ed è curioso che, in una parte 
del mondo famosa per l'antichità della 
sua letteratura, neppure i testi più antichi 
contengano riferimenti validi alla prima 
grande cultura fiorita in quella regione. 
La cultura della civiltà della valle del- 
l'Indo è nota come cultura di Harappa, da 
una delle sue due grandi città: Harappa e 
Mohenjo-Daro. Le difficoltà che si pon- 
gono a chi voglia decifrare la scrittura di 
Harappa sembrano dapprima pratica- 
mente insuperabili: esse derivano in gran 
parte dall'uso limitato che facevano della 
scrittura gli abitanti della regione. I loro 
«testi» consistono quasi esclusivamente 
in brevi iscrizioni su sigilli e in graffiti, in 
quantità altrettanto limitata, su cerami- 
che. Nessuna iscrizione nota constadi più 
di 2 1 segni e ì testi medi ne comprendono 
solo cinque o sei. La brevità delle iscrizio- 
ni, unitamente al fatto che molti fra i segni 
usati sono pittografici, ha sciolto te briglie 
all'immaginazione dì molti studiosi. Sono 
stati compiuti però tentativi molto seri di 
stabilire relazioni fra la scrittura di Ha- 
rappa e quella delle civiltà minoica, cana- 
nea, ittita e persino con la peculiare 
«scrittura» dell'isola di Pasqua. Studi 
compiuti in anni recenti sulla base di ciò 
che la documentazione archeologica rive- 
la sulla vita nella civiltà di Harappa hanno 
consentito di impostare in modo più effi- 
cace il problema della decifrazione, lo mi 
propongo qui di prospettare alcuni fra i 
risultati ottenuti. 

Nei decenni trascorsi dopo la scoperta 
delle due grandi città della cultura di Ha- 



rappa, avvenuta negli anni venti, e parti- 
colarmente dopo la fine della seconda 
guerra mondiale, gli archeologi in India e 
nel Pakistan hanno individuato un mi- 
gliaio di altri siti appartenenti alla stessa 
cultura. Questi siti sono dispersi su un 
grande arco che si estende dall'India oc- 
cidentale, in prossimità del fiume Narma- 
da, verso nord attraverso i distretti di 
Gujarat e di Kutch, passando poi per le 
regioni pakistane del Sind e del Panjab 
occidentale, fino a pervenire nel Rajast- 
han indiano e nel Panjab orientale in 
prossimità di Delhi. Altri insediamenti 
sono stati riportati in luce lungo la costa 
del Mare Arabico quasi fino al confine 
con l'Iran e nel Belucistan; una missione 
archeologica francese ha scoperto di re- 
cente un insediamento addirittura in 
prossimità del fiume Oxo (Amu Darya), 
nel cuore dell'Asia centrale. 

La maggior parte dei siti della cultura dì 
Harappa sono poco estesi, avendo una 
superficie compresa fra 0.8 e 2 ettari, e si 
trovano in vicinanza di fiumi o corsi d'ac- 
qua. Pare che ci siano state tre fasi distinte 
di insediamento, I siti della fase più antica 
si trovano nei territori di confine fra il 
subcontinente e l'Iran o nelle aree imme- 
diatamente circostanti. Quelli della fase 
matura sono molto più dispersi: per la 
maggior parte si trovano nella valle del- 
l'Indo, ma includono anche siti lontani, 
come quelli del Belucistan e quello in 
prossimità dell'Oxo. Anche gli oggetti 
riportati in luce in questi siti più tardivi 
offrono indizi che l'antica cultura di Ha- 
rappa si stava fondendo con popolazioni 
pastorali e agricole locali. Queste scoper- 
te suggeriscono che la civiltà di Harappa 
non abbia avuto termine in modo brusco, 
ma abbia svolto una funzione nello svi- 
luppo dello stile di vita di villaggio, che è 
cosi tipico del subcontinente oggi. 

Che cosa ci dicono i reperti archeologici 
sulla vita nei siti delia cultura di Ha- 
rappa? In primo luogo, essi ci indicano 
che la risorsa principale era costituita dal- 



l'agricoltura: si coltivavano cereali e or- 
taggi e l'allevamento dei bovini era il 
cardine dell'economia del tempo. In se- 
condo luogo, ci rivelano che la cultura 
materiale di quella popolazione era sem- 
plice ma non povera. Gli uomini della 
civiltà di Harappa usavano rame e bronzo 
per la fabbricazione di alcuni utensili e 
armi e a volte lavoravano l'oro e l'argento 
per produrre quelle perline per collane 
che avevano un posto molto rilevante fra i 
loro gioielli. Al tempo stesso, la maggior 
parte dei loro manufatti erano di legno e 
osso, di conchiglie, selce e argilla, tutti 
materiali che abbondavano nella regione. 
Fra le perline, alcune venivano ottenute 
con grande abilità da pietre semìpreziose 
più rare, come l'agata, la corniola e il 
lapislazzuli, (Il sito in prossimità del fiu- 
me Oxo era vicino anche ad antiche mi- 
niere di lapislazzuli.) 

Un altro aspetto sorprendente delia 
vita nella civiltà di Harappa era la grande 
importanza che aveva in essa la standar- 
dizzazione. In architettura, i mattoni era- 
no prodotti secondo formati ben precisi e 
venivano messi in opera rispettando certi 
canoni fissi. I sistemi di drenaggio e di 
eliminazione delle acque di scarico segui- 
vano un modello invariabile. Le abitazio- 
ni avevano dimensioni costanti e talune 
speciali strutture (forse pubbliche) erano 
ubicate rispetto a quelle private secondo 
una planimetria immutabile. In questo 
quadro generate rientrano pesi e misure 
standard, vasellame dalla forma e dall'or- 
namentazione sempre uguali e manufatti 
di aspetto unificato, come mestoli, pesi 
per telaio e anche carri-giocattolo. Al 
tempo stesso, taluni aspetti della vita di 
Harappa, per esempio l'uso di acconcia- 
ture tipiche e dì molteplici braccialetti e 
collane e anche lo stile delle statuine, 
sembrano preannunciare la posteriore 
cultura dell'India. 

Tanto basti per un elenco sommario di 
quanto ci è noto. Ma anche quanto non 
conosciamo può essere altrettanto signifi- 
cativo. Non ci sono indizi di rivalità fra 



vari stati, di guerre, di commerci intema- 
zionali consistenti, o di re e di corti e dei 
grandi complessi dì templi, che sono così 
tìpici delle altre antiche civiltà del Vec- 
chio Mondo. La documentazione archeo- 
logica non ci rivela quasi nulla sulla reli- 
gione o sull'organizzazione politica e so- 
ciale della civiltà di Harappa, benché essa 
abbia avuto grande importanza per te ci- 
viltà che le fecero seguito. I cittadini di 
Harappa coltivarono il cotone e forse il 
riso, addomesticarono i polli e forse in- 
ventarono il gioco degli scacchi e una del- 



le due grandi fonti di energìa non mu- 
scolare dell'antichità: il mulino a vento. 
(L'altra fu la ruota idraulica.) 

Quando fiori questa civiltà enigmatica? 
Benché su questo punto non manchino 
controversie, pare che la fase matura si sia 
estesa press'a poco dal 2200 al 1700 a.C. 
La maggior parte dei siti furono presumi- 
bilmente occupati per non più di 200 anni 
e danno l'impressione di uno sviluppo ef- 
fimero caratterizzato da una robusta or- 
ganizzazione di gruppo e da rapporti re- 
golari fra insediamenti contemporanei. 



Il compito di «leggere» le iscrizioni della 
cultura di Harappa è così difficile che 
molti studiosi lo giudicano irrealizzabile. 
La prima difficoltà deriva dal fatto che 
esse rappresentano la scrittura ignota di 
una lingua ignota per la quale non si cono- 
scono testi bilingui come la Pietra di Ro- 
setta per l'antico Egitto o il monumento 
di Bisutun (Behistun) in Iran. Una secon- 
da difficoltà consiste nell'assenza di testi 
lunghi. L'intero corpus degli scritti consta 
di circa 4000 sigilli, impronte di sigilli e 
graffiti su vasellame; inoltre molti fra i 




Questo sigillo della cultura di l larappa, conservato nel Museo nazionale 
del Pakistan a Karachi, mostra uno zebù. I quattro segni nella parte 
superiore sono fra quelli che compaiono nella griglili alle pagine 28 e 29: 
da sinistra a destra, i tre tratti che designano il numerale 3. il quale ha 
anche ri significato di «primo» o «D più ragguardevole»; una figura 



formata da una foglia di pipai, il fico sacro, e da una freccia, col significato 
di «madre» o «padrona»; una figura umana con «coma», che indica un 
personaggio di alto rango: infine, un recipiente con manici, un suffisso 
onorifico col significalo di «elevalo» o «superiore». Il sigillo apparteneva, 

a quanto pare, a un memoro di alto rango della società, forse una donna. 



22 



23 










«Il Signore delle heslie», un famosa .sigili» conservato nella collezione archeologica del Mimn 
nazionale dell'India a Nuova Delhi, mostra una figura umana seduta con le gambe incrociate, che 
ha sul capo un'acconciatura con vistose coma di bufalo indiano. Le «bestie» associate alla figura 
sono un rinoceronte e un bufalo indiano (a sinistra), un elefante e una tigre (a destra) e una capra 
(in basso), alla cui destra forse ce n'era un'altra, andata perduta quando si ruppe il sigillo. 
L'iscrizione può essere resa così: «Il Nero, il Bufalo Nero an-i(i), l'Alto, il Signore dei Capi». 




i. .V. 




+> 



% 




I graffiti su vasellame, come quelli su questi cocci trovati nel Bellicista ri, sono una seconda fonie di 
segni tipici della cultura di Harappa, Essi non sono numerosi come te iscrizioni sui sigilli e le 
impronte di sigilli, ma indicano che le iscrizioni dovevano essere lette da destra verso sinistra. 



sigilli sono danneggiati e molti graffiti 
sono interrotti in conseguenza di rotture. 
Una terza difficoltà deriva dal fatto che la 
civiltà di Harappa fu non solo geografi- 
camente lontana dalle altre civiltà del suo 
tempo, ma anche storicamente remota 
rispetto ai posteriori sviluppi culturali nel 
subcontinente indiano. 

Per fortuna, i sigilli di Harappa presen- 
tano caratteri scritti e immagini, e i motivi 
figurati possono fornire indizi circa il si- 
gnificato delle iscrizioni, La maggior par- 
te dei sigilli sono pezzi quadrati o rettan- 
golari di steatite, un materiale che si pre- 
sta molto bene a essere inciso. Sulla parte 
posteriore essi presentano per lo più un 
rilievo con un foro attraverso cui doveva 
passare una cordicella; la parte anteriore 
presenta invece una figura in negativo e 
un'iscrizione. Figura e caratteri incisi 
identificavano presumibilmente il pro- 
prietario del sigillo, cosicché, quando il 
sigillo veniva premuto su argilla molle, 
l'impronta ottenuta serviva in un modo o 
nell'altro come riconoscimento del pro- 
prietario del sigillo. 

La maggioranza dei sigilli di Harappa 
presenta uno o l'altro di due motivi fi- 
gurati distinti: il primo è un animale, di 
solito un toro dalle lunghe corna, ma 
sono rappresentati anche zebù, bufali 
indiani, capre, tori dalle corte corna, 
rinoceronti, tigri, gaviali (i coccodrilli 
tipici dei fiumi indiani) ed elefanti. In- 
dipendentemente dal tipo di animale, 
dinanzi a esso era raffigurato un ogget- 
to: quello associato ad animali selvaggi 
o pericolosi è simile a un piatto: quello 
raffigurato davanti agli animali dome- 
stici è o un cesto o (particolarmente 
dinanzi al toro dalle lunghe corna) un 
emblema in forma di «fusto», che com- 
pare anche in raffigurazioni da cui risul- 
ta che veniva portato in processione. 

Alcuni sigilli con animali li raffigurano 
a gruppi. Un esemplare ben noto presenta 
in centro una figura antropomorfica, 
chiamata talvolta il «Signore delle bestie» 
e seduta con le gambe incrociate; sul capo 
ha un'acconciatura caratterizzata dalle 
lunghe corna del bufalo indiano. A destra 
di questa sono visibili un elefante e una 
tigre, a sinistra un rinoceronte e un bufalo 
indiano. Il sigillo è danneggiato, ma in 
basso, sotto la figura centrale, è visibile 
una capra che guarda verso l'alto, e im- 
mediatamente alla sua destra si notano 
quelle che potrebbero essere le corna di 
un'altra figura di capra disposta in modo 
speculare, con la restante parte del corpo 
andata perduta. Un sigillo meno elabora- 
to presenta al centro un pipai o fico sacro 
(Ficus religiosa) ; dal suo tronco spuntano 
le teste di due tori dalle lunghe corna. 

Un'altra raffigurazione di un «gruppo 
di animali» appare su un sigillo prismati- 
co. (Alcuni sigilli della cultura di Harappa 
avevano, infatti, forma prismatica e pochi 
altri formacilindrica.)Su una delle sue tre 
facce sono raffigurati, in fila, un elefante, 
un rinoceronte e una tigre; una quarta 
figura è troppo consumata per essere 
identificabile. Presumibilmente è questa 
la faccia del sigillo dedicata agli «animali 
selvaggi». Sulla seconda faccia è rappre- 



sentata una seconda processione formata 
da quattro animali, nessuno dei quali a 
quanto pare è «selvaggio». Su entrambe 
le facce, però, al di sopra della processio- 
ne dì animali è raffigurato un quinto ani- 
male: un gaviale, che evidentemente fa 
parte del gruppo degli animali «selvaggi». 
Sulla faccia del sigillo riservata a questi 
animali, il gaviale è raffigurato con un 
pesce distintamente riconoscibile davanti 
al suo lungo muso e con quello che po- 
trebbe essere un pesce dietro la coda. Sul- 
la seconda faccia non appare alcun pesce 
riconoscibile. 

Un quarto sigillo, ancora più elaborato 
di quello del «Signore delle bestie», in- 
troduce un elemento di «venerazione». 
Esso ripete la figura del fico sacro, que- 
sta volta nell'angolo a destra in alto. Fra i 
rami dell'albero c'è una figura antropo- 
morfica munita di coma. Di fronte a essa 
si noia una figura inginocchiata e questo 
personaggio indossa una gonna ed è 
quindi presumibilmente di sesso femmi- 
nile; a sinistra della figura inginocchiata 
c'è una grande capra. Sette personaggi 
che indossano gonne occupano la metà 
inferiore del sigillo; i loro capelli sono 
raccolti in una sorta di lunga «coda di 
cavallo». Una scena un po' agghiaccian- 
te, su un quinto sigillo, presenta varie 
figure acconciate in modo simile (una 
delle quali porta una gonna) e attaccate 
da un bufalo indiano. 

Questi motivi danno qualche suggeri- 
mento sull'organizzazione sociale della 
civiltà di Harappa: gli indivìdui che porta- 
no i sigilli appartenevano a gruppi che tra- 
scendevano i normali lignaggi familiari. 
Per esempio, tutti gli individui sul cui sigil- 
lo appariva un rinoceronte dovevano ave- 
re qualche legame sociale in comune, che 
poteva consistere nell'appartenenza a 
qualche gruppo sovrafamilìare, come un 
clan o un'associazione. La raffigurazione 
su alcuni sigilli di scene di processione, 
dove pare che effigi di animali venissero 
portate come stendardi, aggiunge forza a 
questo concetto di gruppi sovrafamiliari. 
Ouesti gruppi, a loro volta, potevano rien- 
trare in un raggruppamento più ampio, 
costituito da due parti, come viene suggeri- 
to dal motivo del «Signore delle bestie» da 
un lato e da quello dei «veneratori della 
divinità del fico sacro» dall'altro. Una tale 
possibile struttura è ben nota agli antropo- 
logi nella forma di una società dualistica, 
caratterizzata dalla classificazione di clan o 
organizzazioni sussidiarie simili in due 
gruppi, o «metà», fra i quali avvengono di 
solito i matrimoni. 

Se si accetta l'ipotesi di lavoro che il 
materiale figurativo rappresentato su cia- 
scun sigillo serva a identificare il portatore 
in funzione del clan e della «metà» del 
gruppo sociale più ampio a cui appartiene, 
ne consegue logicamente che la pane del 
sigillo dedicata all'iscrizione potrebbe ser- 
vire a identificare il portatore del sigillo 
come individuo. L'iscrizione potrebbe for- 
nire, per esempio, il nome dell'indivìduo, 
la sua occupazione, il luogo di residenza, il 
suo rango o titolo, e informazioni analo- 
ghe. A sostegno di una simile interpreta- 
zione, lo studio dei testi dei sigilli rivela 



una considerevole varietà nella sequenza 
dei singoli segni, e al tempo stesso, una 
frequente ripetizione di alcuni di essi. 
Quest'ipotesi fornisce all'ipotetico decifra- 
tore una qualche base su cui procedere. 
Come Michael Ventris sapeva che almeno 
alcuni fra i testi del Lineare B trovati a 
Creta erano inventari di oggetti materiali, 
così chi si accinge a decifrare le iscrizioni 
della cultura di Harappa può procedere 
in base al presupposto che si tratti di 
cercare dei nomi propri ed epiteti elo- 
giativi o altre formulazioni atte all'iden- 
tificazione dell'individuo. 

Già negli anni trenta, lo studioso bri- 
tannico G. R. Hunter aveva identifi- 
cato un totale di ben 396 segni distinti. 
Ricerche più recenti ne hanno aggiunti 
altri 23, cosicché oggi sappiamo che la 
scrittura della cultura di Harappa com- 
prende 419 segni. Un'analisi statistica 
dice anche che essi ricorrono 13 376 
volte, in 2290 testi noti. Dei 419 segni, 
113 sono presenti solo una volta, 47 



compaiono due volte e 59 ricorrono 
meno di cinque volte. Ciò significa che i 
restanti 200 segni erano d'uso più o 
meno generale, e la loro analisi dimostra 
che, per una buona metà, essi sono com- 
binazioni dell'altra metà. 

Queste scoperte dimostrano che la 
scrittura della civiltà di Harappa non era 
né alfabetica, come il sanscrito, né togo- 
grafica (ossìa con un carattere per ciascu- 
na parola), come il cinese. Essa si colloca 
dunque nella categoria nota come logo- 
-sillabica: ciò significa che alcuni segni 
rappresentano parole, mentre altri hanno 
un valore puramente sillabico, o di suoni. 
Altri esempi di scritture appartenenti a 
questa categorìa sono i geroglifici egizia- 
ni, gli antichi ideogrammi sumerici e il 
giapponese moderno. 11 fatto che, per 
metà, i segni di uso comune fossero com- 
binazioni di altri segni usati abitualmente 
fa pensare che chi scriveva, nella civiltà di 
Harappa. si servisse di tali combinazioni 
sia per esprimere idee (come fanno i cine- 
si quando accoppiano i caratteri per sole e 



AFGHANISTAN 




PRABHAS 

MARE ARABICO 

• PRINCIPALI SITI SCAVATI 
O CITTA MODERNE 



CHILOMETRI 



I siti della cultura di Harappa sono slati identificati in un'area che si estende a sud, in India, sin quasi 
a Bombay, a nord fino all'Asia centrate, a est fino a Delhi e a ovest sino al Belucislan, Sulla cartina 
sono indicati 25 fra i principali siti scavati, comprese le grandi città di questa cultura: Mohenjo- 
-Ilarn e Harappa. In genere essi sono poco estesi, coprendo una superficie da 0,8 a 2 ettari. 



24 



25 



(§) ù W 



9 



10 



100 



I numerali della cultura di Harappa, che in origine facevano probabilmente parte di un sistema 
numerico in base ulto. Min» formati da una serie di traiti verticali peri numeri da 1 a 5 e da un sestetto 
di tratti brevi per indicare il 6.11 segno per il numero 7 è formato da una serie simile di tratti brevi. I 
sibili per H e ') Mimi rispettivamente pittogrammi Hi un sole doppio l- ili un «palo di fonda/ione». 

II segno per il numero 10 è un sole singolo recante un tratto breve al suo Interno. Un altro se- 
gno identificato, quello per il numerale 100, è uà pittogramma di un mortaio con un pestello. 



luna per rappresentare la parola «lumino- 
sità») sia per combinare suoni sillabici, 
alio scopo di indicare la «pronuncia» di 
una parola. 

Una parte di cruciale importanza in 
ogni sistema di scrittura è la serie di mezzi 
usati per indicare il genere, per distingue- 
re fra singolare e plurale, per stabilire il 
caso di un verbo e così via, L'identifica- 
zione di questi mezzi è molto importante 
per poter accertare le relazioni che esi- 
stono fra i grafemi, o singoli componenti, 
delle parole e la lingua che i grafemi rap- 
presentano. Ora, i testi della cultura di 



Harappa presentano un accoppiamento 
regolare di certi segni, un po' come avvie- 
ne nelle lingue occidentali per certi titoli: 
per esempio, «Sua Maestà» o «Vostro 
Onore». E anche degno di nota il fatto 
che certi segni appaiano alla metà di un 
testo ma raramente al principio o alla 
fine, mentre per altri segni vale l'inverso. 
L'ordine abituale dei segni e l'identità 
degli accoppiamenti caratteristici posso- 
no essere stabiliti con l'aiuto di una griglia 
o reticolato. Poiché le iscrizioni di Harap- 
pa sono di solito brevi, tale griglia può 
constare di un numero abbastanza limita- 



u 



(FORMULA 

01 RISPETTO) 

1 



D 

(CAMPO) 



m 



in 



(CAMPO 
ARATO) 



V XI TI 



(VERSO NORD) 



(FORMULA DI 

RISPETTO 
-EMINENTE") 



(FORMULA DI 

RISPETTO 
«SUPREMO-) 



U Y 




A 



(UNA MISURA) (AFFERRARE) (CONTROLLARE) FRECCIA (-NOBILE.?) (SALAJPtAZZA) 



Le combinazioni di segni costituiscono la metà del totale dì 200 segni che ricorrono più spesso 
nella scrittura di Harappa. Qui sono presentati quattro esempi: a sinistra in allo, un» fra i segni più 
comuni, un pittogramma di un vaso con manici (indicato col numero arabo 1). Inferiormente a 
esso sono tre segni combinati, costituiti dal segno indicato col numerale 1 (il vaso con due manici) 
più segni come quelli per i numerali 1, 2 e 3, ma formati da trattini corti. Sotto ciascun segno si dà il 
significato in italiano. Sotto i tre segni combinali si osservano, da sinistra a destra, i pittogrammi 
per un recipiente e per un bastoncino biforcuto, oltre a un terzo segno, che risulta dalia loro 
combinazione. A destra in alto è il pittogramma per un campo, un semplice rettangola; accanto a 
esso, è un segno che combina il pittogramma del campo con i tratti del numerale 6 per formare un 
nuovo pittogramma, il cui senso sembra essere quello di «campo arato». A destra in basso, da 
sinistra verso destra, sono i pittogrammi per «freccia» e per «foglia di pipai». Il terzo segno, 
che combina la «freccia» con una «foglia di pipai» parziale, sembra indicare «sala» o «piazza». 



to di colonne verticali: si è di fatto accer- 
tato che 14 colonne sono sufficienti (si ve- 
da l'illustrazione alle pagine 28-29). Delle 
prime 17 iscrizioni scelte per essere pre- 
sentate in righe orizzontali nella griglia, la 
maggior parte constava di cinque o sei 
segni; esse furono perciò inserite in casel- 
le corrispondenti alle colonne centrali, 
lasciando che le righe più lunghe si esten- 
dessero verso destra o verso sinistra. 

Introducendo i testi nella griglia fu su- 
bito evidente che certi segni apparivano 
regolarmente nella maggior parte delle 
iscrizioni. Consideriamo i segni «vaso» 
nella colonna 5, «intreccio da tessitura» 
nella colonna 8 e «due tratti» nella colon- 
na 10. Quando in un uno stesso testo ap- 
paiono due di questi tre segni (come nelle 
righe h, e, h e p), essi sono sempre nello 
stesso ordine da destra a sinistra l'uno 
rispetto all'altro, indipendentemente da 
quali altri segni siano inclusi nell'iscrizio- 
ne. Le loro relazioni sono evidentemente 
governate da una regolarità di posizione. 
Perciò, nella costruzione della griglia per i 
segni della scrittura di Harappa, questi 
furono posti nelle colonne indicate sopra, 
anche quando in un testo particolare ne 
appariva uno solo. 

Emerse chiaramente da questa opera- 
zione che i segni sopra menzionati erano i 
più numerosi fra quelli presenti nei 17 
testi prescelti. Il segno del vaso, riportato 
nella colonna, 5, compare 10 volte, e tre 
sue varianti appaiono in altre due colon- 
ne. Il segno dell'intreccio da tessitore nel- 
la colonna 8, comprese le sue varianti, si 
presenta sei volte, e i due brevi tratti ver- 
ticali della colonna 10, incluse le varianti, 
ricorrono otto volte. Certi altri segni che 
utilizzano tratti verticali non hanno posi- 
zioni relative altrettanto fisse. Mentre il 
gruppo costituito da uno o due brevi tratti 
singoli può essere sistemato nella colonna 
1 0, i gruppi formati da uno, due, tre o più 
tratti più lunghi non trovano posto nelle 
colonne centrali della griglia. 

A questo punto, dopo essersi familia- 
rizzato con l'aspetto di una cinquantina di 
segni, quali appaiono nella griglia analiti- 
ca, il lettore potrebbe chiedersi in quale 
direzione orizzontale essi debbano essere 
«letti». Se dovessimo fondarci sulle sole 
iscrizioni dei sigilli, sarebbe difficile ri- 
spondere a tale domanda. Per fortuna, i 
graffiti incisi sul vasellame hanno fornito 
una risposta: studi eseguiti da B. B. Lai e 
da 11 Mahadevan, dell' Archaeological 
Survey of India, hanno dimostrato che 
alcuni graffiti presentano tratti in parte 
sovrapposti. La sovrapposizione dimostra 
che la direzione della scrittura era da de- 
stra verso sinistra. Ecco perché la colonna 
14 della griglia appare al margine di sini- 
stra e la colonna I al margine di destra. 
L'inversione dell'ordine dei segni per- 
mette di disporli nell'ordine di lettura a 
noi più familiare, cioè da sinistra a destra. 

\7eniamo ora alla parte più complessa 
▼ del problema della decifrazione: 
qual era la lingua della cultura di Harap- 
pa? Quando Ventris identificò la lingua 
del Lineare B di Creta come greco, supe- 
rò la maggiore difficoltà. La documenta- 



zione archeologica della regione in esame 
offre qualcosa dello stesso genere in aiuto 
di coloro che si sforzano di identificare la 
lingua della cultura di Harappa. Per 
esempio, i reperti archeologici dimostra- 
no che tale civiltà non si sviluppò in modo 
subitaneo; essa ebbe una lunga fase pre- 
paratoria nel territorio di confine indo- 
-ìranico. si diffuse poi su un'area molto 
estesa e infine dette un suo proprio con- 
tributo all'emergere dell'India dei villag- 
gi. Questa sequenza suggerisce che la lin- 
gua parlata dalla popolazione della civiltà 
di Harappa non può essere scomparsa del 
tutto dal subcontinente. 

Se accettiamo questo assunto, quale del- 
le tre principali famiglie di lingue parlate 
nella regione potrebbe essere legata alla 
civiltà di Harappa? Fra le famiglie linguisti- 
che prese in considerazione vi è quella 
munda (una famiglia dì lingue parlate in 
gran parte dell'India orientale) che pare 
presentì affinità con certe lingue dell'Asia 
sudori en tale. Studi sulle forme più antiche 
di queste lingue trovano però nel loro voca- 
bolario ben poco che si concili con ciò che 
l'archeologia ci dice sulla cultura di Harap- 
pa. Altro possibile candidato è l'indo-eu- 
ropeo, una famiglia di lingue giunte tradi- 
zionalmente in India alla metà del II mil- 
lennio a.C. L'espressione letteraria più an- 
tica dell'indo-europeo. il Rigveda. descrive 
però una cultura fondamentalmente cen- 
troasiatica del tutto diversa da quella di 
Harappa. Il terzo candidato è il dravìdico, 
una lingua parlata oggi perlopiù nell'India 
meridionale e sudorientale, ma che persiste 
anche in talune sacche dell'India setten- 
trionale e del Belucistan. 

Una quarta possibilità è, ovviamente, 
che la lingua della cultura di Harappa non 
abbia rapporto con alcuna delle famiglie 
linguistiche menzionate sopra. Vale non- 
dimeno la pena di considerare la candida- 
tura del dravìdico con maggiore attenzio- 
ne di quella riservata alle famìglie lingui- 
stiche munda o indo-europea. Oltre alle 
forme settentrionali (kurukh, malto e 
brahui). oggi sono ancora parlate 25 lin- 
gue dravidiche, e le famiglie principali 
(tamil, malayalam. kannada e telegu) 
sono usate da più di 100 milioni di perso- 
ne. Grazie, anche in questo caso, alla 
documentazione archeologica, non è però 
necessario accettare ciecamente la candi- 
datura del dravìdico. 

Nel 1974, scavi condotti nel sito di 
Allahdino, nei pressi di Karachi, riporta- 
rono in luce un frammento di avorio dal- 
la sezione semicircolare. Su un lato c'e- 
rano fori, a quanto pare praticati per infi- 
larvi bastoncini, sull'altro, c'erano due 
solchi paralleli longitudinali. L'oggetto 
era simile a un gran numero di piccole 
verghe d'avorio riportate in luce negli 
anni trenta da E, J, H, Mackay a Mohen- 
jo-Daro, la grande città della cultura di 
Harappa. Gli avori di Mohenjo-Daro 
non erano - com'è stato asserito - sem- 
plici pezzi di un gioco. Per esempio, uno 
di essi, dalla sezione quadrata, presenta- 
va una serie di cerchi e semilune alterna- 
ti, incisi su una faccia. 

Su alcuni avori di Mohenjo-Daro è pre- 
sente un segno di quelli rappresentati nel- 



la griglia (colonna 6, riga e), associato a 
un altro segno che ricorda una pianta. In 
vari testi di sigilli questi due segni si ac- 
compagnano a loro volta a tratti verticali, 
in numero da uno a sette, e ad altri cinque 
segni (due dei quali appaiono nella griglia 
alla colonna 7, riga e, e alla colonna 1 1, 
riga<z). Come il secondo segno sugli avori 
di Mohenjo-Daro. il segno alla colonna 6, 
riga e, sembra rappresentare una pianta, 
probabilmente il culmo di un cereale. Se 
sì considerano l'associazione dei due se- 
gni presenti nelle iscrizioni dei sigilli con 
quelli che sembrerebbero essere dei 
numeri e l'incisione su uno degli avori di 
cerchi e semilune, che si approssimano 
come numero a un mese lunare (semilu- 
na) di 30 giorni solari (cerchi), i due segni 
di piante potrebbero logicamente essere 
interpretati come rappresentanti una 
parola che significa sia cereale sia mese (o 
luna). Inoltre, i tratti verticali associati a 



entrambi ì segni non sono mai più di sette, 
facendo pensare che, per esprimere il 
numero otto, fosse usato qualche altro 
segno e. forse, che il sistema numerico 
della civiltà di Harappa fosse in base otto. 
Quale lingua possiede per un cereale, 
una parola, che significa anche mese o luna 
ed è associata a un sistema numerico in base 
otto? Quanto al primo punto, la parola nel 
significa riso in cinque lingue dravidiche, e 
nila o netu significa luna in tre delle stesse 
cinque lingue e in altre cinque. La medesi- 
ma parola significa in alcune delle stesse 
lingue anche mese. Quanto al secondo pun- 
to, uno studioso delle lingue dravidiche, 
Kamir V. Zvelebil, ha fatto notare che il 
sistema numerico dravìdico originario era 
di fatto, probabilmente, in base otto; il 
conteggio fino a 10. usato in conformità col 
sistema numerico attuale in base 10 proce- 
de (tradotto) letteralmente così: «uno», 
«due», «tre», «quattro», «cinque», «sei». 



\> / * i» 



ARCO 



FRECCIA 



UOMO 



ARCIERE 



f I f i 



PETTINE 



T 



SCRIBA 



UOMO 
CON CORNA 



DONNA 



UOMO 
CON BILANCIERE 



A 



ì 



LANCIA PUNTA UOMO-INTRECCIO 

(ABBREVIAZIONE DA TESSITURA 

DI LANCIA) 



T T 



CULMI DI CEREALI 



FIUMBACQUA 







SOLE 



) 



LUNA 



ALBA'TRAMONTO 



FALCE DI LUNA 



r* 




SPIRALE 



X 



STELLA 



Altri pittogrammi riportati nella griglia, riprodotta nelle due pagine seguenti, sono qui presentati 
assieme ad alcune forme di combinazione. Nella riga in alto, da sinistra a destra, i segni per «arco», 
«treccia», «uomo» e la combinazione «arciere». Nella seconda riga, «pettine», una terza figura 
umana formata da semplici linee, che regge un pettine (combinazione che sembra significare 
«scriba»), una quarta figura umana con «corna», una quinta figura umana con un'acconciatura 
complessa («donna») e un'altra figura lineare che ha sulle spalle un bilanciere a cui sono appesi due 
vasi ( com bi nazio ne che f orse ìnd ica « g uardìa no » ). Nella te r/a riga,dasinistraadestra.una«lancia» 
e l'abbreviazione per «lancia», cioè «punta» (in colore), una formula di rispetto, un «intreccio da 
tessitura» con braccia umane, una seconda formula di rispetto riservata a chi detiene il governo, e i 
due segni combinati. Nella quarta riga due culmi di cereali (entrambi i segni hanno il significato 
intercambiabile di «cereale» o «mese»), un segno col significalo di «fiume» o «acqua» e una spi- 
rale col significato di «cingere» o «dintorni». Nella riga in basso cinque pittogrammi astronomi- 
ci: da sinistra verso destra il sole, la luna, l'alba u il tramonto, la falce di luna e ima Mi'lta. 



26 



27 



«sette», «numero» 
«molti». 



«molti meno uno» e 



Nel corso degli anni gli studiosi hanno 
rilevato la presenza nel dravidico di un 
certo numero di omòfoni: parole che hanno 
lo stesso suono ma significati diversi. Per 
esempio, la parola per designare il bilancie- 
re, la pertica usata per il trasporto di coppie 
di recipienti appesi alle sue estremità, ap- 
poggiando la parte centrale della pertica su 
uno o su entrambe le spalle è k£. La stessa 
parola significa anche guardiano o protet- 
tore. La parola comune per pesce tmìn, che 
è anche la parola per stella. La parola per 
1 00 è nuru, che significa anche macinare o 
polverizzare. 

Il princìpio dell'omofonia, o del rebus, 
si trova in un certo numero di lingue anti- 
che, compresi i geroglifici egiziani. L'e- 
lemento chiave del principio dell'omofo- 
nia consiste nella ricerca di un equivalen- 
te sillabico (per esempio l'immagine di un 
occhio per significare «io») anziché nel- 
l'uso di un segno semplicemente come 
immagine di una cosa. Per esempio, un 
antico sovrano egizio, Nr-mr, era rappre- 
sentato nei geroglifici dal segno di un pe- 
sce gatto (nr) e dal segno di uno scal- 
pello (rrtr). Ciò non significa che egli ve- 
nisse chiamato «pesce gatto-scalpello», 
ma solo che il suo nome aveva un suono 
simile a «pesce gatto-scalpello». 

Queste nozioni ci forniscono una base 
per poter tentare di ricostruire un sillaba- 
rio della cultura di Harappa? Cercherò 
ora di verificare quest'ipotesi, avvertendo 
innanzitutto che la prova del fuoco di 
qualsiasi tentativo di decifrazione è la sua 
coerenza interna. Se si stabilisce che un 
certo simbolo è l'equivalente di un certo 
suono o di un certo significato, non sarà 
lecito usarlo poi per rappresentare un 
qualche altro suono o significato. Una 
logica intema è essenziale a tutti i sistemi 
di scrittura; quando i decifratori modifi- 
cano arbitrariamente i valori dei simboli 
per adattarli al modello che preferiscono, 
il loro lavoro è destituito di ogni valore. 

Consideriamo innanzitutto il segno rap- 
presen tato n e 1 1 a colon n a 7 , riga A . Pìttogra - 
ficamente esso potrebbe essere interpreta- 
to come la rappresentazione di un mortaio e 
di un pestello. Ricostruzioni linguistiche 
suggeriscono che, nel dravidico, quest'u- 
tensile aveva il valore sillabico nuru. Que- 
sto, come abbiamo visto, è anche il suono 
del verbo macinare o polverizzare e il nome 
di «100». Consideriamo poi il segno che 
figura con tanto rilievo nella colonna 5 della 
griglia. Alcuni anni fa, Mahadevan ipotizzò 
che questo segno, che appare per lo più alla 
fine dei testi sui sigilli, fosse una rappresen- 
tazione pittografica di un recipiente con 
manici. Rilevò, inoltre, che varie parole 
dravidiche per questo tipo di recipiente 
erano omòfone con parole che significava- 
no maschio, comprendenti anche il comune 
suffisso onorifico art usato con nomi di per- 
sona maschili almeno sino all'inizio dell'era 
cristiana. Il fatto che un tale segno si trovi 
alla fine di testi sui sigilli, per i quali è 
legittima l'ipotesi che contenessero nomi 
di persona, corrobora la congettura for- 
mulata da Mahadevan. 



a FEMD 606 


14 


13 


12 


n 


10 


9 


e 


7 


6 

lì 


5 

U 


4 


3 


2 


1 


b HAR 16 








$ 


I 


OC 


« 




$ 


u 










C HAR 99 

















Ù 


T 


u 










d HAR 72 










A 


I 




S 




oC 


u 










e FEMD 590 











II 




ì 






t 










f MD-31 121 








K 


II 








1 


Ofò 










g MD-31 46 


















4 


t 


= 








h MD-31 26 






ri 




II 






LD 


U 


u 










ì HAR 110 








X 


') 








A 


u 










/ HAR 102 










I 






$ 


* 


u 










k FEMD 111 






III 


t 


II 






Di!) 


* 


A 




1 






/ MD-31 69 




fi 


A 


A 






















m HAR 69 


UT 


\$ 


ili 


É 






















n MD 650 








) 


) 


\J 






« 


V 










O MD 405 








) 


') 


XJ 


ì 




)) 


u 










p FEMD 48 











II 




$ 


r 


f 


V 










Q ME-31 110 




% 


cCK 


A 




« 


£ 









y 









Questa griglia analitica, comprendente 14 colonne, contiene 17 lesti di sigilli, la cui lunghezza varia 
da due a nove segni. Quando i segni per «vaso» furono assegnali tutti alla colonna S, i segni 
«intreccio di tessitura» e le toro varianti alla colonna 8 e i segni composti da due brevi tratti verticali 
alla colonna 10, fu evidente che se due o piti di questi tre segni apparivano in un'iscrizione, essi erano 
tra loro sempre nello stesso ordine da destra a sinistra, indipendentemente da quali altri segni 
potessero essere presenti nel testo. Le righe />. e, A ep forniscono quattro esempi. I singoli tratti 



verticali nella colonna 10 (righe A, d e / 1 rivelano una qualità llessiva. Lo 
stesso segno appare anche in Torma combinata nella colonna 12, riga d. 
in aggiunta al segno per «sole»; nella colonna 1 1, riga k . in aggiunla al 
segno «uomo», e nella colonna 9, righen eo, in aggiunta al segno «vaso». 
Il senso dei singolo segno e della sua combinazione (righe i,neo) pare sia 
quello di un possessivo; il senso del doppio I ratto pare sia quello di un 



locativo. Due testi, alle righe lem, non rientrano nella «normale» 
distribuzione al centro della griglia : si può quindi supporre che siano testi 
dalla formulazione insolita. Quando, all'interno di una casella detta 
Krij;li;i, sì trovano due segni, ciò indica che essi sono regolarmente 
accoppiati nei testi dei sigilli. Nella figura alta pagina seguente in basso 
si dà un'ìnterprelazione di quattro di questi 17 lesti (righe d,t,g e k). 



28 



29 




I uinlut(i della cultura di H;ir:i[i|>;t tini la Me so potarli ia sono attcstali dalla scoperta, in questa 
regione, di sigilli della cultura dell'Indo, Quello mostrato qui. con il sigillo a sinistra e l'impronta 
dello slesso a destra, fu scoperto nel 1975 da McGuire Gibson, dell'Orientai Infittite dell'Univer- 
sità di Chicago, fra le rovine di una casa del periodo camitico a Nippur, un'antica città dell'Iraq. 



Ora, un altro dei segni finali sulla gri- 
glia (colonna 5, riga/) è un pittogramma 
di una figura umana che trasporta sulle 
spalle un bilanciere con un recipiente 
appeso a ciascuna estremità. Come ab- 
biamo visto, la sillaba per un bilanciere, 
kà, è omòfona con parole dravidichc si- 
gnificanti «fare la guardia» o «protegge- 
re». Inoltre una parola dravidica comune 
per uomo è ài. La combinazione di queste 
due sillabe consente di ricostruire il segno 
della colonna 5, riga/ come parola Disil- 
labica kà-àl. Nelle lingue dravidiche, per 
ragioni eufoniche, due vocali consecutive 
sono separate da una consonante, una v o 
una v. La parola così ottenuta, kàvàj, po- 
trebbe essere tradotta «colui che fa la 



<r t 



guardia o protegge», una formulazione di 
identità personale idonea a essere regi- 
strata su un sigillo privato. 

Per dare altri due esempi, prima di ten- 
tare la lettura di alcuni testi di sigilli ripor- 
tati nella griglia, due fra i segni «numeri- 
ci» - il segno nella colonna 1 2. riga k, che 
significa presumibilmente tre, e un se- 
condo segno formato da quattro tratti 
verticali, che significa presumibilmente 
quattro - hanno anch'essi omòfoni plau- 
sibili. Il primo omòfono, mu(n), è uguale 
alla parola dravidica che significa «primo, 
il più ragguardevole» (mun); il secondo 
omòfono, nSl, è uguale alla parola che 
significa «buono» (nal) : due aggettivi che 
si prestano a specificazioni di rango. 



♦ " A ? 



pan 



m 



pirikey 



C) (!) A 



paia 



ambara 



àra-pirikay 



OC U 



patu-kàni 



ì " uj a * a 



àl-à 



un 



Bmban 



otu malya 



Quattro iscrizioni di sigilli sono qui riprodotte assieme al valore sillabico di ciascun segno in 
dravidico, una famiglia di antiche lingue pariate nella regione e che sopravvive ancora oggi. 
L'iscrizione più breve (a), nell'interpretazione fattane dall'autore, è «il segno del cantore». 
L'iscrizione successiva (b), che ripete la formula di rispetto in terza persona rappresentata dal 
segno per «lancia», tir, è interpretata come «appartenente alla nobile casa (del) Pìrikeyar», 
L'iscrizione successiva (e) è composta da sette segni e comprende una variante del segno «intrec- 
cio da tessitura» dell'Iscrizione b. Pud essere interpretata come «Patukaran, potente (nobile) ca- 
po degli insediamenti circostanti». L'ultima iscrizione fili comprende nove segni, fra cui il segno 
con due tratti i(l) dell'iscrizione b e un'abbreviazione (in colore) del segno per «lancia», presente 
sia in a sia in b. L'iscrizione suona cosi: «Appartenente a Muntila, padrona di It)u campi arati, 
nobile primadonna». A tutt'oggi sono stati letti più di 100 testi di sigilli. La maggior parte delle 
letture si accorda con l'ipotesi che i segni dei sigilli abbiano la funzione di identificare persone. 



/Consideriamo ora due testi di sigilli 
^ brevi e due più lunghi fra quelli ripor- 
tati nella griglia. Il testo designato come 
Mohenjo-Daro 3 1 46 (rigag) è composto 
da tre segni, che si presume rappresentino 
uno strumento musicale, una lancia e un 
pettine. I valori sillabici dravidici assegna- 
ti sono, nello stesso ordine, pan, àr eki(r), 
che tradotti corrispondono alla parola 
«canto», a una espressione onorifica in 
terza persona e alla parola «segno»; la 
parola completa viene letta come Panàr- 
-ki(r). La traduzione proposta è «sigillo di 
Panar» o, letteralmente, «il segno del 
cantore», fi testo designato come FEMD 
590 (riga e) è formato da quattro segni. Il 
primo segno, che ha la figura di un rombo, 
ha il valore trisillabico ara-man ; il secon- 
do, costituito da due brevi tratti verticali, 
ha il valore ì(l) ; il terzo, un «intreccio da 
tessitura», ha il valore trisillabico pi- 
ri(key), e il quarto è la stessa espressione 
onorifica ar del testo precedente. Questo 
testo viene letto Ara-man-ì(l) pìrikeyar, e 
per esso viene proposta la traduzione 
«appartenente alla nobile casa (del) Pìri- 
keyar» («pir» e «pirikey» sono capi). 

Il terzo testo, Harappa 72 (riga d), è 
composto da sette segni: esso si apre con 
una spirale (cur), a cui seguono un ovale- 
che racchiude un breve tratto verticale 
(paia), una foglia di pipai e una freccia 
combinate assieme (ambara), un breve 
tratto verticale da solo (a), un intreccio 
sormontato da una punta (àra-pirikey), 
chele combinate col segno del sole (patu- 
-kant) e, come segno finale, il vaso con 
manici (ari). Si ottiene una frase piuttosto 
lunga; Cur patàmbara-a àra-pirikey papi- 
-kàran. La traduzione proposta è «Patu- 
karan. potente (nobile) capo degli inse- 
diamenti circostanti». Il quarto testo, 
FEMD 1 1 1 (riga k), è una fra le più lun- 
ghe iscrizioni di sigilli tradotte ed è forma- 
to da nove segni. Per brevità vengono 
indicate solo le sillabe e la traduzione 
proposta: Munàla-i(t) nuru càruvara am- 
ba n aròru malya, ossia «appartenente a 
Munala, padrona di 100 campi arati, no- 
bile primadonna». 

Finora sono stati assegnati valori silla- 
bici a quasi 1 00 segni contenuti in sigilli e 
in iscrizioni su vasellame; per ciascuno 
sono stati trovati appropriati omòfoni 
dravidici. Sono state proposte, inoltre, 
per più di 100 iscrizioni su sigilli, tradu- 
zioni come quelle riportale qui e che 
vanno da espressioni semplici come «re- 
cipiente per acqua» (probabilmente un 
nome proprio) ad ampollosità come 
«Arasamban, Grande Capo (dei) Capi 
del Sudovest. stirpe della Luna», 

Ciò che tati testi dimostrano è che un 
certo numero di individui della civiltà di 
Harappa (fra cui Arasamban) facevano ri- 
salire la loro stirpe a figure importanti del 
cosmo, come il sole, la luna e le stelle e 
forse anche la pioggia monsonica. Queste 
potrebbero essere distinzioni all'interno di 
ciascun clan, I capi erano associati ad ara- 
mani, case di capi, che forse avevano fun- 
zioni sia residenziali sia amministrative. 
C'era inoltre un luogo elevato (le «cittadel- 
la idem i l'ìciilc dagli archeologi?) che as- 
solveva una funzione speciale, ma finora 



non identificata. Un'area destinata a riu- 
nioni - un cortile aperto o una sala con 
colonnato (esempi di entrambi questi spazi 
sono stati riportati in luce dagli archeologi) 
- permette di ipotizzare che un'assemblea 
dì capi fosseelemento essenziale dell'orga- 
nizzazione politica di Harappa, 

Fra gli altri tipi di capi, che conosciamo 
dai sigilli, c'erano capi di associazioni 
(corporazioni?), come quelle dei ramai, 
degli ispettori ai magazzini, dei superviso- 
ri all'irrigazione, e dei proprietari di ter- 
reni, una categoria che, come abbiamo 
visto, includeva anche donne. Sono inve- 
ce scarsi i riferimenti religiosi. C'è forse 
una «divinità con corna», designata come 
«quello dì rame» o «il rosso» e forse una 
«dea madre», ma per il momento si at- 
tendono conferme. Fra le figure minori 
c'erano suonatori di tamburi e cantori: è 
probabile che i primi convocassero te as- 
semblee e i secondi intrattenessero forse 
le persone convenute o cantassero duran- 
te le cerimonie. 

I sigilli attestano inoltre l'esistenza di 
una classe di scribi, di persone incaricate a 
sovrintendere ai pesi e alle misure e di 
ispettori alla distribuzione delle merci. 
alla macinazione dei cereali e probabil- 
mente a operazioni di caccia. C'erano 
anche capitani di imbarcazioni e custodi 
del fuoco. Molti sigilli contengono il se- 
gno kà, che si riferisce alla funzione di 
guardia, non in senso militare ma piutto- 
sto nel senso di una responsabilità per la 
cura dei raccolti e la proiezione delle 
mandrie e delle greggi. Una fra le con- 
ferme più incoraggianti che le decifrazio- 
ni stanno procedendo nella giusta dire- 
zione proviene dal sigillo prismatico in cui 
si osserva due volte un gaviale al di sopra 
di una serie di animali di «clan». Nel dra- 
vidico la parola per coccodrillo è mutalai. 
La parola dravidica per primo capo, muta- 
li, è un omòfono molto simile. 

Pare dunque che la lingua di Mohenjo- 
-Daro e di Harappa, circa 4000 anni 
fa. fosse un'amica lingua dravidica e che 
gli scribi della cultura dì Harappa si sfor- 
zassero di tradurre la lingua in forma gra- 
fica, come modo per identificare l'elite 
della civiltà della valle dell'Indo. La civil- 
tà di Harappa era però così diffusa geo- 
graficamente che nella lingua deve essere 
entrato un certo numero di parole non 
dravidiche, esattamente come parole 
dravidiche furono in seguito prese a pre- 
stito da popolazioni che parlavano l'in- 
do- europeo, 

Una grande mole di lavoro di decifra- 
zione rimane ancora da compiere e senza 
dubbio si troverà che quanto è stato 
esposto qui non è senza pecche. Il compi- 
to che attende i decifratori è ancora più 
affascinante, poiché dovrebbe condurre 
a un risultato che fino a poco tempo la 
sembrava irraggiungibile: fornire infor- 
mazioni coerenti sulla forma statale, sul- 
l'organizzazione sociale e sull'ideologia 
della civiltà di Harappa, e forse anche 
prove più attendibili del fatto che la cul- 
tura di Harappa, essendo all'origine del- 
l'India dei villaggi di oggi, non è mai del 
tutto scomparsa. 



O. 



uesto mese potete trovare in edicola 
e in libreria l'ottavo quaderno dì «Le Scienze» 
dal titolo I LASER. Per l'occasione 
Orazio Svelto, esperto a livello mondiale del settore, 
ha integrato con numerosi, aggiornatissimi interventi 

questa raccolta 

LE SCIENZE pi !j! articol j> 

quaderni m i llustran K d ° tutte 

le possibilità 
offerte da questa 
nuova, 
promettente 
tecnologia. 




I LASER 






numero 

8 






m«Q0O t90 



Otto QUADERNI all'anno, 
ogni mese da ottobre a maggio. 
Formato cm 21 x 29. 
Prezzo di copertina: L. 4000 



In questo numero: 

Applicazioni biomediche del laser di C, A. Sacchi e R. Pratesi 

// laser nei processi lavorativi di A. V. La Rocca 

La separazione laser degli isotopi di R, N, Zare 

Ologrammi in luce bianca di E. N. Leith 

Armi laser di K. Tsìpis 

inoltre di O. Svelto: 

/ principi, la storia e gli sviluppi dei laser 

Le applicazioni dell'olografìa 

Metrologia laser 

Le applicazioni militari dei laser 

Lettura e registrazione d'informazione mediante laser 

e di B. Costa e F. Tosco: 
Comunicazioni su fibre ottiche 

Non dimenticate l'appuntamento a ottobre con il quaderno: 
GLI OROLOGI BIOLOGICI a cura dì Alberto Oliverio. 



30 



31 



La microprogrammazione 

Nei calcolatori moderni il flusso delle informazioni è controllato, 
al livello più basso, da un microprogramma: un insieme di istruzioni 
memorizzate che sta al posto di un sistema di controllo cablato 



Come controllare, o pilotare, i se- 
gnali elettrici che rappresentano 
le informazioni costituisce un 
problema fondamentale nella progetta- 
zione di qualunque calcolatore. Nell'uni- 
tà aritmetica e logica, dove avviene l'ef- 
fettiva elaborazione dell'informazione, i 
segnali debbono essere instradati fra vari 
contatori, sommatori e altri componenti. 
Il sistema di controllo deve anche media- 
re il trasferimento di informazioni fra l'e- 
laboratore centrale, le unità della memo- 
ria principale e i vari dispositivi di ingres- 
so e di uscita. In uno dei modi possibili di 
risolvere il problema, il sistema di control- 
lo è completamente cablato, cioè definito 
in forma permanente nei circuiti elettrici 
dell'elaboratore. Esiste tuttavia un'altra 
impostazione, più flessibile e in molti casi 
meno costosa. L'idea è in sostanza quella 
di ridurre la complessità del sistema di 
controllo registrando, in forma codificata, 
le istruzioni particolareggiate necessarie 
per controllare il calcolatore. In altre pa- 
role, la successione di percorsi che un 
segnale deve seguire è depositata in un 
programma, che viene immagazzinato in 
una unità di memoria distinta, incorpora- 
ta nell'elaboratore. 

Nella gerarchia dei programmi e ho 
consentono il funzionamento di un calco- 
latore, le istruzioni eseguite dal sistema di 
controllo occupano il livello più basso, il 
più elementare: ogni istruzione specifica 
un unico, particolare stato funzionale del- 
la macchina. Dato che le istruzioni di con- 
trollo riguardano particolari cosi di detta- 
glio, il compito di definirle e di codificarle 
viene chiamato micro programmazione, 
introducendo una distinzione fra questa 
attività e la stesura di programmi di alto 
livello, per i quali si parla genericamente 
di software. Si dice che un insieme di 
istruzioni di controllo - un micropro- 
gramma - è scritto in microcodice. L'idea 
della microprogrammazione non è affatto 
nuova, ma risale a oltre 30 anni fa, all'e- 
poca immediatamente successiva alla rea- 
lizzazione dei primi calcolatori. A quel 
tempo {"hardware necessario per tradurre 
l'idea in realtà non esisteva ancora, ma 



di David A. Patterson 



oggi il metodo è stato adottato nella mag- 
gior parte dei calcolatori. 

Negli ultimi anni si è fatta non poca 
confusione intorno al significato del ter- 
mine «microprogrammazione», in gran 
parte per l'introduzione del microelabo- 
ratore, il «calcolatore su un singolo chip», 
che costituisce il cuore dei più recenti 
prodotti della progressiva miniaturizza- 
zione nella tecnologia dei semiconduttori, 
basata sul silicio. Bisogna avere ben chia- 
ro che la microprogrammazione di un cal- 
colatore non si identifica con la pro- 
grammazione di un microcalcolatore: in 
linea di principio qualunque calcolatore, 
dai massimi sistemi «mainframe» fino ai 
più piccoli «personal computer», può es- 
sere progettato con un sistema di control- 
lo microprogrammato. Per evitare questa 
confusione a volte i micro program mi 
sono classificati come «firmware», con un 
termine che in qualche modo indica anche 
il loro stato a mezza via fra hardware e 
software. Per amor dì chiarezza, in questo 
articolo userò questa convenzione: chia- 
merò macroistruzione una istruzione di 
software e parlerò invece di microistru- 
zioni quando vorrò fare riferimento a 
istruzioni di firmware. 

T>rima di poter spiegare la micropro- 



grammazione, è necessario passare 



in rassegna alcuni principi di base del- 
l'hardware e della programmazione dei 
calcolatori. Sotto molti aspetti un calco- 
latore non differisce da una calcolatrice 
tascabile. In ambedue gli apparecchi è 
possibile introdurre dei numeri, per mez- 
zo di una tastiera, ed è possibile leggerli 
su una unità di visualizzazione. Alcune 
calcolatrici dispongono di un tasto di 
memoria, che consente la registrazione 
di un numero, in modo da poterlo in se- 
guito recuperare; anche l'unità di memo- 
ria in un calcolatore ha il compito di ar- 
chiviare numeri e di consentirne in segui- 
to il recupero. La memoria di un calcola- 
tore, però, e in grado di gestire milioni di 
numeri e, per poter conservare traccia di 
così tanti elementi, a ciascuno viene as- 
segnato uno specifico indirizzo. 



Sia a una calcolatrice tascabile, sia a un 
calcolatore, bisogna dire esattamente che 
cosa devono fare. Una istruzione è per un 
calcolatore esattamente quel che e, per 
una calcolatrice, la pressione di un tasto di 
funzione. Per esempio, quasi tutti i calco- 
latori accettano le macroistruzioni add, 
SUB, MULTe Dtv.che corrispondono esat- 
tamente ai tasti di una calcolatrice con- 
trassegnati dai simboli +,— ,-Xe -^.Ana- 
logamente, la m acro istruzione Load (che 
significa letteralmente «carica») svolge lo 
stesso ruolo del tasto della memoria in 
una calcolatrice. 

A differenza di una semplice calcolatri- 
ce, però, un calcolatore è eminentemente 
una macchina che prende decisioni. Per 
capire la distinzione, consideriamo la 
sequenza di operazioni rappresentata dal- 
le ultime righe del modulo 1040. il modu- 
lo per la dichiarazione dei redditi per le 
persone fisiche negli Stati Uniti (si veda 
l'illustrazione in alto a pagina 35). Un 
programmatore che si trovi di fronte al 
compito di completare il modulo può 
cominciare con la stesura di un diagram- 
ma di flusso, che gli serve come una sorta 
di «scaletta» per la costruzione di un pro- 
gramma (si veda l'illustrazione in basso a 
sinistra a pagina 35). Il contribuente che 
lavora con una semplice calcolatrice ta- 
scabile potrebbe seguire il diagramma di 
flusso, eseguendo le istruzioni in succes- 
sione, fino a quando non raggiunge la ca- 
sella di forma romboidale, forma che in- 
dica come in quel punto debba essere pre- 
sa una decisione. Allora confronterebbe i 
numeri nelle due righe precedenti: a se- 
conda di quale dei due risulta più grande, 
sceglierà la strada opportuna per prose- 
guire i suoi calcoli. 

Un contribuente che abbia a disposi- 
zione un calcolatore, anziché una sempli- 
ce calcolatrice, potrebbe fare un passo di 
più: potrebbe fare in modo che il calcola- 
tore prenda la decisione da solo. Seguen- 
do il diagramma di flusso, in primo luogo 
direbbe al calcolatore di sommare succes- 
sivamente ì numeri scritti nelle righe della 
dichiarazione, dalla 50 alla 58 comprese, 
memorizzando il risultato di ciascuna 




REG 



ALU 



PLA 



Y 



SEQ 



ROM 



K 



TST MUX 



INTERFACCIA MPB 



Questo microelaboratore micro program matti è l'elemento centrale dei calcolatori della 
famiglia Ili" 9000 della Hewlett Packard. TI circuito microelettronico ha la densità mas- 
sima finora raggiunta: contiene t'equivalente di circa 450 000 transistori su un chip 
quadrato di silicio di 6,3 millimetri di lato. La spaziatura tipica fra le linee che portano i 
segnali è di un micrometro. Il diagramma a sinistra indica le selle sottosezioni principali 
del chip. L'area in colore identifica le sottosezioni che costituiscono il sistema di control- 
lo dell'elaboratore e l'area bianca corrisponde al percorso dei dati. II sistema di controllo 
è costituito da quattro parti: una memoria a sola lettoni (ROSfi. dove sono immagazzi- 
nale le micToìstnizioni per il controllo del flusso di informazioni in tutto il calcolatore; 
una matrice a logica programmata (PLA), dove la maggior parte delle mìcroistnizioni 
vengono decodificate prima di venire trasmesse alle loro varie destinazioni; un dispositi- 
vo sequenziatore (SEQ) dove viene stabilito l'ordine delle micro istruzioni, e un selettore 
(mul(iptexer) di controllo (TST MUX), dove vengono decodificate talune mìe roist razioni 
condizionali. Le tre altre sotloserioni sono una schiera di registri di memoria (REG), 
dove i dati manipolati dal calcolatore sono immagazzinati sotto forma di «parole», 
ciascuna delta lunghezza di 32 bit; una unità aritmetica e logica (ALU), dove viene ef- 
fettuala ta vera elaborazione delle parole da 32 bit, e un'interfaccia verso il bus memoria- 
. elaborato re (MPB) che effettua la supervisione delle comunicazioni fra il chip elabora- 
tore e il resto del calcolatore. Le forme rettangolari sul bordo in alto, in basso e a destra 
del chip comprendono dispositivi di controllo, sene mi di risoluzione speciali e segni di 
allineamento che non hanno a che fare con il funzionamento del microelaboratore. 



32 



33 



Stó ^^fi gPfi* 



iiiiiirrf 



fnrmiifeM 



; ! 



■ ■ a ■ 



Questo microelaboratore non microprogrammato si distingue per la sua sezione di controllo 
cablata, estremamente irregolare, che occupa l'ampia sezione a destra nella fotografia. Le due 
aree più piccole e più regolari a sinistra corrispondono alle sottosezioni REG e ili dell'illustra- 
zione delta pagina precedente. Per la sua irregolarità, un sistema di controllo cablato di questo tipo 
è difficile da progettare e modificare. Quando questo chip fu costruito (nel 1978) i progettisti 
pensavano che la micro programmazione avrebbe richiesto un chip di dimensioni molto superiori. 



addizione in uno specifico indirizzo della 
memoria del calcolatore: in questo caso 
gli indirizzi dei numeri sono indicati come 
L50, LSI, £-52, e via di seguito, e vengo- 
no sommati progressivamente a un in- 
dirizzo che funge da «accumulatore», 
chiamato A (si veda l'illustrazione in bas- 
so a destra a pagina 35). Il totale di questa 
successione di passi verrebbe poi imma- 
gazzinato all'indirizzo L59. Poi il pro- 
grammatore farebbe lo stesso per le righe 
dalla 60 alla 66, immagazzinando il totale 
per questa seconda serie di somme all'in- 
dirizzo L67. A questo punto (passo 19), 
darebbe al calcolatore la macroistruzio- 
ne: «JUMPlF/t < £.59, 23». Questa ma- 
croistruzione, del tipo chiamato «satto 
condizionato», dice al calcolatore di co- 
minciare una nuova serie di macroistru- 
zioni, al passo 23, se il numero nell'indi- 
rizzo dell'accumulatore è minore del 
numero immagazzinato all'indirizzo £.59. 
In caso contrario, il calcolatore continue- 
rà con il passo 20. 

È la macroistruzione di salto condizio- 
nato, corrispondente alla casella romboi- 
dale ne! diagramma di flusso, che fornisce 
al calcolatore la capacità di prendere de- 
cisioni, purché ovviamente il programma- 
tore sappia o possa rappresentare le deci- 
sioni come semplici controlli aritmetici. Il 
programmatore costruisce un programma 



architettando una gran quantità di salti 
condizionati che portano ciascun numero 
fornito in ingresso alla sua corretta desti- 
nazione. In media, su dieci macroistru- 
zioni in un programma di calcolatore, una 
è una macroistruzione di salto condizio- 
nato; molti fra i calcolatori di oggi posso- 
no eseguire una macroistruzione in meno 
di un milionesimo di secondo, e pertanto 
in un secondo un calcolatore, tipicamen- 
te, prende più di 100 000 decisioni di 
questo genere. Le macroistruzioni per le 
decisioni sono a loro volta codificate sotto 
forma di numeri e immagazzinate insieme 
con gli altri numeri gestiti dal calcolatore 
nella memoria principale. Il princìpio del 
programma memorizzato, la cui inven- 
zione ha costituito una pietra miliare nel- 
lo sviluppo del moderno calcolatore digi- 
tale, rende possibile modificare la funzio- 
ne di un calcolatore cambiando i contenu- 
ti della sua unità di memoria, invece di 
dover modificare il suo hardware. 

Con l'aumento della velocità dì calcolo, 
ì calcolatori possono eseguire un maggior 
numero di m acro istruzioni e prendere un 
maggior numero di decisioni, a parità dì 
tempo; quindi diventa possibile far girare 
programmi di complessità sempre cre- 
scente. In questa situazione è difficile evi- 
tare gli errori. I programmatori preferi- 
scono usare termini dalle connotazioni 



meno negative Risentirete dire spesso che 
un programma «ha bisogno di una messa 
a punto». (In inglese la terminologia è più 
colorita: si parla infatti di un «bug», anzi- 
ché di un errore, e il procedimento di 
messa a punto è detto «debugging», cioè 
spulciare, togliere le pulci.) Per capire 
meglio il senso particolare di questa uso 
linguistico, prendiamo ancora in conside- 
razione l'illustrazione del modulo per la 
dichiarazione dei redditi riportata nella 
pagina a fronte. La riga 68 dice al contri- 
buente che cosa deve fare se la cifra ripor- 
tata alla riga 67 è maggiore della cifra alla 
riga 59, e la riga 7 1 spiega che cosa fare se 
la cifra nella riga 59 è maggiore di quella 
nella riga 67, ma in tutto il modulo, e nelle 
istruzioni che lo accompagnano, non si 
trova un punto che spieghi che cosa si 
deve fare se le cifre nelle righe 59 e 67 
sono uguali! Chiaramente l'Internai Re- 
venue Service degli Stati Uniti ha dimen- 
ticato un piccolo errore nel suo program- 
ma. Questo è proprio il tipo di dettaglio 
che un programmatore deve tener pre- 
sente quando scrive e mette a punto un 
programma di calcolatore. La difficoltà 
del compito aumenta fortemente quan- 
do si scende ai dettagli finissimi della 
scrittura e della messa a punto di un mi- 
croprogramma. 

Oer vedere come un calcolatore possa 
■*■ prendere decisioni ed eseguire ma- 
croistruzioni, dobbiamo guardare un po' 
più a fondo nel funzionamento dell'unità 
centrale di elaborazione. L'elaboratore è 
costituito da due parli principali: il siste- 
ma di controllo, che prende le decisioni ed 
emana di conseguenza i comandi alle altre 
parti dell'hardware, e l'unità aritmetica e 
logica, il percorso dei dati, in cui vengono 
effettivamente svolti i calcoli. Al cuore 
dell'unità aritmetica e logica sta un som- 
matore. e in linea di principio tutte le 
funzioni aritmetiche possono essere ri- 
dotte a serie ripetitive di passi di addizio- 
ne. Ogni parte dell'elaboratore ha la pro- 
pria schiera di dispositivi di memoria a 
breve termine, chiamati registri. 

A questo livello l'organizzazione del 
calcolatore assomiglia a un impianto 
idraulico. Possiamo pensare i fili che col- 
legano i vari dispositivi dell'hardware 
come tubature che incanalano il flusso di 
informazione. II sistema di controllo diri- 
ge il flusso inviando un segnale di «on» o 
di «off» peraprireo chiudere ciascuno dei 
molti dispositivi elettronici, analoghi a 
valvole, chiamati porte (si veda l'illustra- 
zione in alto a pagina 36). Le porte deb- 
bono chiudersi e aprirsi ;tl momento giu- 
sto perché l'informazione possa arrivare 
correttamente a destinazione, e quindi i 
segnali di controllo debbono essere invia- 
ti con grande precisione temporale. Per 
questo il ritmo di tutto l'elaboratore è 
sincronizzato con un orologio interno. 
Ogni macroistruzione corrisponde a una 
sequenza di cicli di orologio, dove ogni 
ciclo contrassegna un singolo trasferi- 
mento di informazione lungo il percorso 
dei dati. La funzione del sistema di con- 
trollo è quella di fornire i segnali di con- 
trollo durante i cicli di orologio giusti. 



I 50 Balance. Subtract fine 49 Iroro Ime 40 and enter ditferenee <but not less than zero) ►• | 50 



Other 
Taxes 

(Includine 
Advance 
EIC 
Payments) 



06 



51 Self-employment tax (artach Schedule SE) 

52 Minimum tax (attaeh Form 4625) - • 

53 Alternative minimum tax (attach Form 6251) 

54 Tax from recapture of investment credit fattaci Form 4255) 

55 Social security (FICA) tax on tip meome not reported to employer (affaci) Form 4137) 

56 UncoNected employee FICA and RRTA tax on tips (from Form W-2) 

57 Tax on an IRA (attedi Form 5329) 

58 Advance earned meome credit I.F-IC) payments teceived (from Form W-2) 



59 Total tax. Add Imes 50 ttirougri 58 



51 

52 

53~ 

54 

55 

56 

57 

58 

59 



Payments 

AUach 
Form* W-2. 
W-2G. and 
W-2P 
to troni. 



60 Total Federai income tax withheld 

61 1982 estimated tax payments and amounl applted from 1981 return . 

62 Earned meome credit, ff line 33 is under $10,000, see 
page 15 of Instructions 

63 Amount pani with Form 4868 

64 Excess FICA and RRTA tax withheld (two or more employers) . 

65 Credit for Federai tax on special fuels and oils (artach 
Form 4136) , 

66 Regulated Investment Company credit (attach Form 2439) 



60 
61 



62 

63 
64 



65 
66 



67 Total. Add lines 60 through 66 . 









Retiniti or 
Amount 
You Owe 



66 
69 
70 
71 



It line 67 is larger than line 59, enter amount OVERPAID . , . 

Amount of line 68 to be REFUNDED TO VOU 

Amount ut Ime 68 to be applied to your 1983 estimated tax ... ► I ^° 



tf Ima 59 is larger than Ime 67, enter AMOUNT YOU OHE. Altach check or money order for full amount 
payabie to Internai Reuenue Service. Wnte your social security number and "1982 Form 1040" on it, ► 
(Check ► I"] it Form 2210 (221QF) is atlached See page 16 ol Instructions.) ► $ 



68 



69 



Qucstu modulo dà un esempio di una serie di operazioni effettuabili 
con un programma di calcolatore. L'illustrazione riproduce le ultime 22 



righe del modello 1040, la dichiarazione dei redditi delle persone 
fìsiche degli USA per il 1982. preparalo dall'I n le mal Revcnue Service. 



i 


(.59 = L50 + (.51 + L52 + L53 + (-54 + (.55 
+ (.56 + (.57 +L58 


w 


1.67 = (_60 + (.61 + (.62 + (.63 + (.64 + (.65 
+ L66 



INDIRIZZI 



ISTRUZIONI 



VERO 




FALSO 



(.66=1.67 -L59 




i» (.71 = L59 - (-67 



/ STOP \ 



1 


LOAD L50 A 


3 


ADD (.51. A 


3 


ADD L52. A 


4 


ADD (.53. A 


5 


ADD (-54. A 


6 


ADD L55, A 


7 


ADD (-56. A 


8 


ADD L57. A 


9 


ADD 1.58. A 


10 


STORE A. 1.59 


11 


LOAD 1.60. A 


12 


ADDL61.A 


13 


ADD L62, A 


14 


AOD 1.63. A 


15 


ADD 1.64. A 


16 


ADD (.65. A 


17 


ADD (.66, A 


18 


STORE A, L67 


19 


JUMPIFA<(.59. 23 


20 


SUB A. L59 


21 


STORE A, L68 


22 


STOP 


23 


LOA0 (-59. A 


24 


SUB (.67, A 


25 


STORE A, (.71 


26 


STOP 



COMMENTI 



Questo diagramma di flusso funge da scaletta 
per la successione delle opera/ioni necessarie 
per completare le ultime 22 righe del modulo 
1040. Le cifre scritte su ciascuna riga del modu- 
lo vengono immagazzinate in un indirizzo par- 
ticolare della memoria del calcolatore; qui gli 
indirizzi dei numeri sono indicali come Z.50, 
£.51, £52 ecc. I :i casella a forma di rombo 
è il simbolo usato per un pass» «decisionale». 



A = LSO 

A - (.50+151 

A = L50+(.51+i.52 

A - LS0+LS1+L52+Ì.53 

A = LS0+L51 +(.52+1.53+1.54 

A =(_50+L51+L52+(.53+i.54+L55 

A = l_50+l-S1+L52+L53+L54+LS5+(.56 

A =L50+i-51+l.52+L53+i.54+L5S+(.56+L57 

A -1.50+1.51 +L52+L53+L54+1.SS+1.56+L57+L58 
L59 = (.50+1.51 +LS2+1.53+LS4+L55+L56+1.57-K.58 

A = (.60 

A = (-60+L61 

A = 1.60+1.61 +(.62 

A = L60+Ì.61 +L62+L63 

A m L60+L61+1.62+L63+L64 

A = (.60+L.61+L62+t.63+i.64+(-65 

A = i.60+L61+L62+L63+(.64 + L65+(.66 
1.67 ■ L60+L61+1.62+L63+Ì64+L65+L66 
VAI ALL'INDIRIZZO 23 SE A < L59 (CIOÈ SE (.67 < (.59) 
(L67 > L59) PERTANTO 1.67 - L59 
(.68 = t-67 - (.59 
FINE 
(1,67 < L59) PERTANTO L59 - L67 

A = L59 - L67 
L71 ■ A (= (.59 - 1.67) 
FINE 



Questo programma di ma croisl razioni per il completamento del modulo 1040 segue il diagramma 
di flusso. Ogni macroìst razione è immagazzinata a sua volta in un particolare indirizzo di memoria 
(prima colonna a sinistra). 1 numeri agli indirizzi LSD, £51, /,52 ecc. vengono sommali in suc- 
cessione a un indirizzo «accumulai ore» indicalo come .1. I passi da 1 a 10 corrispondono alla ca- 
sella più in alto net diagramma di flusso e i passi da 1 1 a 1 8 corrispondono alla seconda casella 
dall'alto. La macrois trazione di salto condizionato al passo 19 equivale alla casella di decisione a 
Torma dì rombo. I passi 20 e 21 corrispondono al percorso «falso» del diagramma di flusso, mentre 
i passi 23, 24 e 25 corrispondono al percorso «vero». I commenti a destra sono note del program- 
matore per ricordare che cosa sta succedendo; non influenzano l'esecuzione del programma. 



34 



35 



SISTEMA DI CONTROLLO 



PERCORSO DEI DATI 



CARICA IN fi 
CARICA IN A 

a + e 

A - B 

8 -A 

A 

CARICA IN C 

SCEGLI IL SOMMATORE 

SCEGLI L'INGRESSO 

SCEGLI LA MEMORIA 

CARICA IN D 

CARICA IN E 

SCEGLI C 

SCEGLI D 

ALLA MEMORIA 

ALL'USCITA 



1 A 



IO 



12 



13 



14 



15 



16 



V 



SOMMATORE 



c^ 



:3> 



INGRESSO 



:=5^ 



DALLA 
MEMORIA 



V 



V 






ALLA 
MEMORIA 



USCITA 



Questo elaboratore centrate ideale si basa su 16 fili di controllo (linee in colore) per guidare i 
segnali elettrici che rappresentano le informazioni lungo un percorso dei dati semplificato (linee in 
nero). In questo caso l'unità aritmetica e logica possiede solo un dispositivo dedicato: un somma- 
(«re, che riceve numeri da due fili di ingresso, li somma o ti sottrae in base a comandi ricevuti 
attraverso i fili di controllo da 3 a 6, e invia il risultato lungo un filo di uscita. Le forme rettangolari 
sono registri, componenti di memoria a breve termine che possono contenere una parola di 
informazione alla volta. Le forme triangolari sono porte, dispositivi che lasciano passare l'infor- 
mazione quando il filo di controllo associato è attivato e la bloccano quando il filo non è attivato. 
In un elaboratore non microprogrammato ciascuno dei comandi nella sezione di controllo è 
definito da un hardware di controllo specifico. Nella versione microprogrammata ogni comando è 
immagazzinato sotto forma di mi ero istruzione nella memoria di microprogramma. Un micropro- 
gramma campione per questo elaboratore è dato nell'illustrazione in alto netta pagina a fronte- 



SALTA SE C < 

INDIRIZZO DELLA 
MICROISTRU2IONE 


» ^ 


SEGNO DI C 






X 


^ + 1 




\ V V 

\ SnMMATrtHF 


t 


\ 


\ 






i 




F 








1 





È necessario altro hardware perché la versione micro program mata dell'elaboratore semplificato 
nell'illustrazione in allo in questa pagina possa prendere decisioni di salto condizionato. Il registro 
F contiene l'indirizzo, nella memoria iti microprogramma, della mi crolsl razione che al momento 
ha il controllo del percorso dei dati, [.a funzione del sommalore in più è quella di sommare ano 
all'indirizzo della microistrozione attuale, trasmettendo quindi l'indirizzo della microistruzione 
che segue nel microprogramma. Il sommato» inoltre rinvia informazioni dai percorso dei dati al 
sistema di controllo. Il segno del numero nel registro C passa attraverso una porta controllata dal 
filo 17 nel terzo ingresso del sommatore. Quando questo filo è nofT», viene eseguita la microislru- 
/ioni' a /-' - I . l'indirizzo successivo (perché + F + 1 equivale a F + 1 ). Il sommatore somma 
i)0 +f + 1 o 1 + F + la seconda che il numero nel registro C sia positivo o negativo. Quin- 
di con l'aiulo del cavo di controllo 17 il micro program malore pud effettuare un salto condizio- 
nato a una microistruzione, dove la condizione per il salto e il segno del numero in C. Il 
microprogramma per questa operazione è dato nell'illustrazione in basso nella pagina a fronte. 



In un sistema di controllo cablato biso- 
gna progettare una rete di logica elettro- 
nica che riconosca ogni macroistruzione 
ne! repertorio del calcolatore. La macroi- 
struzione in sé è una successione di cifre 
binarie, codificata in una serie di segnali 
inviati all'elaboratore. Il sistema di con- 
trollo pertanto deve in qualche modo tra- 
sformare questa serie di segnali nell'in- 
sieme di segnali, del tutto diverso, neces- 
sario per aprire e chiudere le varie porte 
nel percorso dei dati. Inoltre, i segnali 
emessi dal sistema di controllo debbono 
essere articolati nel tempo in modo da 
coincìdere con gli opportuni cicli di oro- 
logio. Ogni macroistruzione deve dar 
luogo a una diversa successione di segnali 
di controllo, e pertanto il sistema diventa 
sempre più complesso, al crescere del 
numero delle m acro istruzioni. Cambia- 
menti e messe a punto possono essere 
effettuati esclusivamente attraverso una 
modificazione del cablaggio. 

Agli inizi dell'industria dei calcolatori 
la progettazionedeirtiardware di control- 
lo era un problema di grande rilievo. Al 
confronto il compito di progettare gli altri 
componenti dell'hard ware era abbastan- 
za facile. Una telescrivente poteva funge- 
re da dispositivo di ingresso e di uscita e la 
ripetitività delle strutture di memoria e 
degli elementi circuitali nel percorso dei 
dati semplificava la loro progettazione e 
la loro costruzione. L'hardware necessa- 
rio per contare i cicli di orologio e per 
.emettere i segnali di controllo al momen- 
to opportuno rendeva invece il sistema di 
controllo molto irregolare, il che a sua 
volta rendeva molto più difficile il compi- 
to di progettare questa parte dell'elabora- 
tore centrale. 

Nel 1949 Maurice V. Wilkes dell'Uni- 
versità di Cambridge si dedicò alla ricerca 
di un modo migliore per organizzare la 
funzione di controllo. Dopo due anni di 
studio concluse che l'impostazione mi- 
gliore era quella di pensare il sistema di 
controllo come una matrice, una griglia 
rettangolare, in cui ogni riga di quadratini 
corrispondesse a un ciclo di orologio e 
ogni colonna fosse associata a un filo di 
controllo. Per esempio, l'elaboratore 
semplificato nell'illustrazione qui in alto a 
sinistra ha 16 fili di controllo, pertanto la 
corrispondente matrice di controllo ha 1 6 
quadratini di lato (in allo nella pagina a 
fronte). Per scegliere una successione di 
operazioni, è sufficiente quindi inserire 
una opportuna combinazione di cifre bi- 
narie nei quadratini: per tutti i fili di con- 
trollo che debbono essere «o/r» durante 
un particolare ciclo di orologio si seri ve un 
1 nel corrispondente quadratino, mentre 
per tutti i fili di controllo che devono esse- 
re «offa si scrive uno 0. 

L'hardware equivalente alla matrice di 
controllo è una struttura di memoria 
semplice e ripetitiva. Il contenuto di cia- 
scuna cella in una riga determina lo stato 
della corrispondente linea di controllo 
per la durata di un ciclo di orologio. La 
successione di cifre che costituisce una 
macroistruzione serve soltanto a sceglie- 
re la riga opportuna {o la opportuna serie 
di righe) nella memoria di controllo. In 



FILI DI CONTROLLO 




MICROISTRUZIONI 



Questo microprogramma campione per una singola mscrolstruzione 
che può essere eseguila dall'elaboratore semplificalo dell'illustrazione 
ìn allo nella pagina a fronte consiste di una serie di righe in una matrice 
di controllo, una griglia rettangolare in cui ciascuna riga corrisponde a 
una microtstruzione e ogni colonna è associata a un filo di controllo. Per 
ogni filo di controllo che deve essere attivato durante un particolare 
ciclo di orologio si scrive un 1 nel quadrato corrispondente; si scrive 



FILI DI CONTROLLO 



COMMENTI 
CARICA A - fi IN C; VAI A 2 
CARICA C IN A 
CONTINUA 



invece uno in ogni quadrato che corrisponde a un filo di controllo che 
non deve essere attivato. (Nel disegno «on» è rappresentato anche dal 
colore e «off» dal bianco.) L'operazione controllata dal micropro- 
gramma è la sottrazione del numero immagazzinato nel registro di 
memoria B dal numero immagazzinato nel registro accumulatore A e 
il successivo immagazzinamento del risultalo in A. Come nel caso delle 
macroistruzioni, i commenti sono solo noie per il programmatore. 




MICROISTRUZIONI 



Questo micro program ma «decisionale» usa l'hardware dì controllo 
potenziato raffigurato nell'illustrazione in basso nella pagina a Ironie. 
L'operazione controllata dal microprogramma è il caricamento nel 
registro E del numero che si trova nel registro D. Il salto condizionato 



COMMENTI 
CARICA A - fi IN C; VAI A 2 
SE C < VAI A 4 
CARICA D IN E; VAI A 4 
CONTINUA 



richiede l'aggiunta di un quadrato nella matrice, per rappresentare il 
comando di saltare alla microistruzione 4 se il numero nel registro C è 
negativo (colonna 17). Quindi la macrolstruzione di salto condizionato 
si riduce a una scelta fra la micro istruzione 3 e la microistruzione 4. 



altre parole, la macroìstruzione diventa 
un indirizzo che individua la riga. La 
progettazione di un sistema di controllo 
diventa allora più una questione di soft- 
ware che di hardware: la complessità sta 
nella scelta della giusta successione dì 1 e 
di da immagazzinare in memoria, anzi- 
ché nello specificare la giusta combina- 
zione di circuiti cablati per generare se- 
gnali di controllo, 

Wilkes si rese conto della somiglianza 
che corre fra questo suo metodo e la co- 
mune programmazione, tanto che prese a 
prestito i termini tipici della programma- 
zione per descrivere le sue idee, aggiun- 
gendo sempre però il prefisso «micro-». 
per indicare la natura elementare della 
funzione di controllo: da qui derivano 
«microprogrammazione» e tutta la fami- 
glia di termini a quello apparentati. In 
particolare Wilkes chiamò mìcroistruzio- 
ne ciascuna riga di quadratini nella matri- 
ce di controllo e microprogramma ogni 
successione di righe che esegue una singo- 
la macroistruzione. La struttura di memo- 
ria progettata per contenere il micropro- 



gramma viene chiamata memoria di mi- 
croprogramma. L'idea della micropro- 
grammazìone ha reso più facile la com- 
prensione della funzione di controllo e, 
sostituendo ì complessi circuiti di control- 
lo con una schiera rispettiva di celle di 
memoria, ha reso più facile la costruzione 
dell'hard ware; ma quel che più importa è 
che ha dato al calcolatore una nuova fles- 
sibilità: a questo punto il sistema di con- 
trollo può essere modificato senza dover 
ri progettare l'hardware. 

Prendiamo in considerazione un micro- 
programma campione per l'elabora- 
tore semplificato di cui abbiamo parlato 
prima (si veda l'illustrazione in aito in que- 
sta pagina). Supponiamo che l'operazione 
controllata dal microprogramma sia la 
sottrazione del numero immagazzicato 
nel registro di memoria B dal numero 
immagazzinato nel registro accumulato- 
re A e quindi l'immagazzinamento del 
risultato in A. Esaminando il percorso dei 
dati nel diagramma dell'hardware si può 
vedere che il dispositivo etichettato 



«sommatore» è in grado non solo di 
sommare i due numeri, ma anche di sot- 
trarre l'uno dall'altro. Prima dì poter ri- 
porre il risultato in A, però, bisogna tener- 
lo temporaneamente nel registro Ci 
quindi bisogna caricare, e poi scaricare, il 
registro C sul percorso dei dati che riporta 
ad A. L'operazione di sottrazione richie- 
de due microistruzioni. La prima dice al 
sommatore di sottrarre il numero in B dal 
numero in A e di inviare il risultato in C; 
corrispondentemente vengono attivati i 
fili di controllo 4 («A-B») e 7 («carica 
IN C»). La microistruzione successiva 
sposta l'informazione da C in A, aprendo 
una porta nel filo che parte da C per far 
passare l'informazione fino ad A; quindi 
debbono essere attivati i fili di controllo 
13 («scegli C») e 2 («carica in A»). 

Consideriamo ora un microprogramma 
un po' più complicato per il medesimo ela- 
boratore. Il secondo microprogramma ri- 
chiede un processo decisionale simile al 
salto condizionato che abbiamo visto nel 
programma per la dichiarazione dei redditi. 
La decisione si riduce a una scelta fra due 



36 



37 



mìcroistruzioni. A questo fine bisogna 
aggiungere un quadrato in più alle microi- 
struzioni e un cavo di controllo in più 
all'elaboratore. L'hardware di controllo 
cosi potenziato è raffigurato nell'illustra- 
zione in basso di pagina 36; il micropro- 
gramma riveduto è riportato nell'illustra- 
zione in basso della pagina 37, 

L'operazione controllata dal secondo 
microprogramma è il caricamento nel re- 
gistro E del numero che sì trova nel regi- 
stro D se A è maggiore o uguale a B. In 
primo luogo si sottrae 6 da A e si imma- 
gazzina il risultato in C. Se il numero in C 
è negativo, ne segue che A è minore di B e 
quindi la decisione è di saltare la microi- 
struzione successiva e di riprendere il 
microprogramma alla microistruzione 4. 
Se, invece, il risultato della sottrazione è 
un numero positivo o è zero, A è maggio- 
re o uguale a B, e il microprogramma 
procede alla microistruzione successiva, 
che carica in E il numero in D. Si aggiunge 
un quadratino alle microistruzioni per 
dare ti comando di saltare alla microistru- 
zione 4 se C è negativo, e corrisponden- 
temente si aggiunge un filo di controllo 
all'hardware dell'elaboratore. 

Si dice che una macroistruzione è «in- 
terpretata» dal microcodice per dare i 
segnali di controllo che manipolano effet- 
tivamente il flusso di informazioni nel 



percorso dei dati. Quindi la successione di 
microistruzionì nel secondo esempio so- 
prariportato è l'interpretazione in micro- 
codice della macroistruzione di salto con- 
dizionato scritta come «JUMP1F» al passo 
iy del programma per la denuncia dei 
redditi. Il microprogramma affronta il 
semplice test aritmetico presentato dal 
programmatore dirigendo l'hardware a 
controllare il numero nel registro C per 
vedere se è negativo e, in caso di risposta 
affermativa, lo dirige a eseguire l'oppor- 
tuna microistruzione di salto condiziona- 
to. Per poter operare un controllo del 
genere l'hardware deve rimandare infor- 
mazioni dal percorso dei dati al sistema di 
controllo. L'hardware necessario per de- 
terminare se il numero in C è negativo è 
semplicemente un filo partente da C, che 
rappresenta il segno del numero in quel 
registro: il filo è off (0) quando il segno è 
positivo (il che significa che C è maggiore 
o uguale a zero) e on (1 ) quando il segno è 
negativo (il che significa che C è minore 
di zero). 

T a sostituzione di semplici strutture ripe- 
-■- J titive dì memoria al posto di comples- 
si circuiti di controllo cablati porta due 
vantaggi principali: rende più facile capi- 
re e costruire il sistema di controllo e ren- 
de più facile modificare il sistema. Un 



SISTEMA DI CONTROLLO 
CODIFICATO 

IN MODO FILI DI CONTROLLO 

MASSIMALE Al DECODIFICATORI 



FILI DI CONTROLLO VERSO 
DECODIFICATORI IL PERCORSO DEI DATI 





CARICA 


1 


000 
001 
010 
011 
100 
101 
110 


1 CARICA IN a 


^_ 


2 CARICA IN A 




7 CARICA IN C 




2 


1 1 CARICA IN D 


> 


CARICA 




3 


12 CARICA INE 




CARICA 




4 


15 ALLA MEMORIA 








16 ALLUSCITA 










3 A + B 




00 
01 

10 

11 




4 A - B 




SOMMATORE 




5 


5 B - A 






SOMMATORE 






6 A 








8 SCEGLI IL SOMMATORE 








ALLA MEMORIA 


6 


00 
01 
10 


9 SCEGLI L'INGRESSO 




7 




ALL'USCITA 
SCEGLI 


10 SCEGLI LA MEMORIA 




e 










13 SCEGLI C 






1 




14 SCEGLI D 




9 


^_ 






SALTA 




17 SALTA SE C < 













Il numero dei fili di controllo può essere ridotto codificando ulteriormente i segnali di contrullo e 
introducendo opportuni dispositivi di decodificazione. In generale questo metodo comporta il 
reperimento di due fili che raramente sono attivati insieme per la medesima microist razione e 
l'eliminazione di uno di essi, in modo che l'altro possa svolgere una duplice funzione. Questo 
diagramma schematico del l'hardware raffigura una versione codificata in mudo massimale dell'e- 
laboratore raffigurato nelle due ili us trazioni a pagina 36. 1 fili di controllo verso il percorso dei dati 
sono stati disposti in modo diversi) per meltere in evidenza quelli cudificali insieme nel nuovo 
sistema di controllo. L'ulteriore codificazione in genere ha come esito un sistema di controllo più 
lento di un sistema codificato in modo minimale (un sistema in cui ugni quadrato di micropro- 
gramma è messo in corrispondenza con un filo di controllo), perché minore è il numero delle 
operazioni che possono procedere simultaneamente e perché i segnali di controllo debbono 
passare attraverso i decodificatori. Inoltre il microprogramma che ne risulta tende ad avere un 
numero più elevalo di mìcroistruzioni. Però, dato che ciascuna micro istruzione è composta da un 
minor numero di cifre binarie, il costo della memoria di microprogramma può ridursi di molto. 



38 



errore in un sistema di controllo micro- 
programmato può essere corretto sempli- 
cemente modificando i contenuti della 
memoria. Per esempio, supponiamo di 
decidere di cambiare il microprogramma 
precedente in modo che carichi in E il 
numero che si trova in D non quando A è 
minore di B, ma quando B è minore di A. 
La prima microistruzione del micropro- 
gramma dipartenza carica in C il risultato 
dii4-B. Se però sì pone in off il filo 4 e in 
on il 5, la microistruzìone caricherà in C il 
risultato dì B-A. In ciascun caso la mi- 
croistruzione successiva determina se il 
numero in C è minore di zero ed effettua il 
salto se la risposta è affermativa. Quindi si 
può correggere l'operazione cambiando 
lo stato di due soli fili di controllo in una 
micro istruzione. Con un sistema di con- 
trollo non mìcroprogrammato bisogne- 
rebbe modificare la struttura dell'hard- 
ware, per poter effettuare la medesima 
correzione. 

Oltre a ridurre il costo di una correzio- 
ne nel sistema di controllo, la micro pro- 
grammazione consente di modificare 
completamente il sistema di controllo 
cambiando tutti i contenuti della memo- 
ria di microprogramma. Quindi un unico 
sistema dì hardware può svolgere molte 
Funzioni diverse. 

I vantaggi del microcodice sono risulta- 
ti quasi subito evidenti. L'idea di Wilkes. 
però, precorreva un po' i tempi rispetto 
alla tecnologia dell'hardware. La micro- 
programmazione richiede strutture dì 
memoria veloci e poco costose, come non 
erano disponibili negli anni cinquanta. 
Inoltre, allora sì pensava in genere che un 
calcolatore progettato in modo da sfrutta- 
re questo ingegnoso sistema sarebbe stato 
più lento di una macchina con sistema di 
controllo cablato. Dì conseguenza la mi- 
croprogrammazione è rimasta per oltre 
un decennio poco più che una curiosità 
intellettuale. 

Solo agli inizi degli anni sessanta la mi- 
croprogrammazione è venuta alla ribalta, 
in gran parte come esito di una fondam en - 
tale decisione commerciale della Interna- 
tional Business Machines Corporation 
(IBM). Verso la fine degli anni cinquanta, 
la IBM era diventata in effetti una serie di 
piccole società, ciascuna delle quali com- 
mercializzava il proprio tipo di calcolato- 
re. I calcolatori erano diversi non solo per 
dimensioni, velocità e prezzo, ma anche 
per l'insieme dì macroistruzioni di cui 
erano dotati: di conseguenza i programmi 
studiati per un tipo di calcolatore IBM 
non potevano girare su un altro calcolato- 
re della stessa ditta. Ovviamente sarebbe 
stato molto più facile vendere calcolatori 
che funzionassero con un software comu- 
ne e che differissero solo per dimensioni, 
velocità e prezzo. II problema era convin- 
cere i dirigenti delle «società» consociate 
della possibilità, sia per i progettisti dei 
calcolatori più veloci, sia per i progettisti 
dei calcolatori più economici, di costruire 
macchine efficienti basate sullo stesso in- 
sieme di macroistruzioni. 

I dirigenti delle società consociate fu- 
rono d'accordo sull'idea innovativa di una 
famiglia di calcolatori a software compa- 



tibile solo perché furono persuasi della 
realizzabilità di un tale progetto attraver- 
so la microprogrammazione. Se sì poteva 
microprogram mare lo stesso hardware in 
modo da eseguire insiemi diversi di ma- 
croistruzioni (questo fu il ragionamento). 
allora si doveva poter microprogrammare 
calcolatori diversi in modo che eseguisse- 
ro lo stesso insieme di macroistruzioni. [ 
vantaggi commerciali del concetto di fa- 
miglia sembrarono tali che la IBM operò 
un rilevante investimento nello sviluppo 
di tecnologìe di memoria in grado di por- 
tare a memorie di microprogramma velo- 
ci e poco costose. Infine, nel 1964. la IBM 
annunciò una famiglia di sette modelli di 
calcolatori, a software compatibile, che 
differivano fra loro in velocità per un fat- 
tore 300 e in costo per un fattore 100. 

Quasi come in un ripensamento, alla 
IBM si decise che la microprogramma- 
zione avrebbe potuto contribuire anche al 
compito di rendere compatibili i pro- 
grammi per i vecchi calcolatori con i nuovi 
modelli. Di conseguenza diversi modelli 
della nuova famiglia IBM furono prodotti 
con due microprogrammi: uno per il nuo- 
vo insieme di m acro istruzioni e un altro 
per il vecchio insieme. In questo modo gli 
utenti potevano far girare ì loro vecchi 
programmi sul nuovo hardware, senza 
doverli modificare. Il metodo si dimostrò 
tanto indovinato che per i primi anni sa- 
rebbe stato difficile dire se le nuove mac- 
chine passavano più tempo a funzionare 
con il microprogramma per le nuove ma- 
croistruzioni o con il microprogramma 
che emulava le vecchie. 

Presto la maggior parte degli altri co- 
struttori di calcolatori seguirono l'e- 
sempio della IBM e cominciarono a ba- 
sarsi sul microcodice per produrre una 
famiglia dì calcolatori a software compa- 
tibile formata da macchine molto diverse 
fra loro per velocità e prezzo. La difficoltà 
principale incontrata lungo questa strada 
fu la duplicazione della costosa tecnologia 
delle memorie inventata dai tecnici della 
IBM. Tuttavia alta fine il rapido sviluppo 
della tecnologia microelcttronica ha risol- 
to il problema. Per più di un decennio 
ogni anno t'industria dei semiconduttori è 
riuscita a raddoppiare la quantità dì in- 
formazioni immagazzinabile in un unico 
chip di memoria. Questa tecnologia ha 
consolidato la posizione della micro pro- 
grammazione, come metodo di controllo 
d'elezione, per tutti gji anni settanta. Le 
eccezioni sono stati i «supercalcolatori», 
gli elaboratori più veloci e più costosi: nel 
loro caso si preferisce ancora un controllo 
dedicato, per la sua maggiore velocità, 
anche se è più difficile da costruire. 

Quando, circa un decennio fa, apparve- 
ro sulla scena i microelaboratori, si pose 
naturalmente il problema di come proget- 
tare il loro sistema di controllo. La storia 
si è ripetuta: i primi microelaboratori 
sono stati costruiti con sistemi di controllo 
non mi ero program ma ti. Con il maturare 
della tecnologia, però, i vantaggi della 
microprogrammazione hanno convinto la 
maggior parte dei progettisti di microcal- 
colatori ad adottare il microcodice. 





Sai qual è 

l'olio giusto 

per le automobili 

a gas? 




Questa 131 Supermirafiori 1600 ce. è alimentata a GPL. 
Qual è l'olio più adatto per questa vettura (e per tutte 
quelle alimentate a gas)? 



a 
fi 



La risposta esatta alla pagina seguente. É 



FILI DI CONTROLLO 



MICROISTRUZ10NI 




COMMENTI 

CARICA A - B INC; VAI A 2 
SE C < VAI A 4 
CARICA D IN E. VAI A 4 
CONTINUA 



Questo micruprogramma, codificato in modo massimale, per il sistema di controllo della pagina 
38 viene definito «verticale», perché di solito possiede un numero più elevato di microistra- 
zkmi di minore lunghezza il che rende la sua rappresentazione più lunga e più stretta della 
rappresentazione di un corrispondente microprogramma «orizzontale». In questo caso la codifi- 
cazione è siala effettuata in modo che non si rendesse necessaria alcuna microist razione ulteriore. 



Nel frattempo dall'idea della matrice 
semplice in cui ogni quadratino corri- 
sponde a un singolo filo di controllo si è 
evoluto un altro tipo dì microprogram- 
mazione. 1 miglioramenti sono venuti 
soprattutto dal tentativo di ridurre il costo 
della memoria di microprogramma. Nel- 
l'esecuzione di una qualunque microi- 
struzione in genere succede che siano at- 
tivi solo pochi componenti dell'hardware; 
i fili di controllo che portano a tutti gli 
altri elementi sono off. Ne risulta che un 
microprogramma tende ad avere isole di 
1 sparse qua e là in un mare di 0. Se si 
potesse raggiungere lo stesso obiettivo 
con una minore quantità di memoria (cioè 
con un minor numero di 0), si potrebbe 
ottenere una memoria meno costosa. La 
soluzione sta nel fornire la stessa infor- 
mazione al percorso dei dati codificando 
ulteriormente i segnali di controllo. In 
generale l'ulteriore passo di codificazione 
comporta il reperimento di due fili che 
raramente sono entrambi attivati per la 
medesima microistruzione e l'eliminazio- 
ne di uno dei due, cosicché l'altro può 
svolgere una duplice funzione. Questa 
impostazione tende a dare un maggior 
numero di microistruzioni, ma ciascuna 
microistruzione ha un minor numero di 
cifre binarie. Si dice che un insieme di 
micro istruzioni codificato in modo mas- 
simale è «verticale», perché i micropro- 
grammi che ne risultano sono in genere 
lunghi e stretti. Un insieme di microistru- 
zioni codificato in modo minimale viene 
detto invece «orizzontale» perché i mi- 
croprogrammi che ne risultano sono in 
genere corti e larghi. In generale le mi- 
croistruzioni codificate in modo minimale 
portano a calcolatori più veloci, perché 
consentono l'esecuzione simultanea di 
più operazioni. 

Con il crescere dell'importanza della 
microprogrammazione è aumentato an- 
che l'interesse per metodi che consentano 
anche agli utenti dei calcolatori di scriver- 
si i propri microcodìci. La possibilità di 
trasformare il calcolatore da un solutore 
di problemi di carattere generale in una 
macchina «tagliata» su misura per una 



ben precisa applicazione ha notevoli van- 
taggi potenziali, il che ha reso un'idea 
attraente la microprogrammazione da 
parte dell'utente. Fin qui i migliori risulta- 
ti ottenuti da utenti che hanno scritto i 
propri programmi in microcodice hanno 
dimostrato un incremento di velocità 
massimo pari a un fattore 10. Nella prati- 
ca il guadagno in velocità dipende dal par- 
ticolare percorso dei dati del calcolatore 
microprogrammato e dalla particolare 
applicazione; in alcuni casi il vantaggio 
sul piano della velocità è molto inferiore, 
e a volte può anche capitare che non vi sia 
alcun miglioramento. 

Nella maggior parte dei calcolatori mi- 
croprogrammati le microistruzioni sono 
immagazzinate in una sorta di memoria a 
sola lettura, i cui contenuti sono determi- 
nati quando la memoria viene prodotta. 
Un altro tipo dì calcolatore micropro- 
grammato è in grado di modificare i conte- 
nuti della sua memoria dì microprogram- 
ma in pochi millesimi di secondo solamen- 
te, mentre il calcolatore è in funzione. Si 
parla allora di macchine con una memoria 
di controllo riconfigurabile (writabte con~ 
trolstore). La chiave di questa impostazio- 
ne sta nell'avere la disponibilità di molte 
applicazioni diverse, microcodificate, cari- 
cabili solo quando necessario. Dotando il 
calcolatore di una memoria dì controllo 
riconfigurabile è possibile rimuovere la 
barriera di hardware che ostacola la mì- 
croprogra mutazione da parte dell'utente. 

Nonostante questi tentativi, la micro- 
programmazione è rimasta cosi diffi- 
cile che solo pochi utenti hanno saputo 
sfruttarne a pieno il potenziale. Per que- 
sto alcuni ricercatori hanno affrontato il 
problema di facilitare la scrittura in mi- 
crocodice. Sotto molti aspetti la situazio- 
ne è simile a quella che si venne a creare 
agli inizi della storia della programma- 
zione. Allora il problema era la difficoltà 
di disporre migliaia di m acro istruzioni in 
un programma che funzionasse senza fal- 
le. Quel problema ha spinto i program- 
matori a scrivere programmi speciali che 
aiutassero la stesura dei programmi ap- 



plicativi. I programmi speciali traducono 
i linguaggi dì programmazione di alto 
livello nelle macroistruzioni più semplici 
che un calcolatore è in grado di eseguire. 
I linguaggi di alto livello come BASIC e 
Pascal sono più facili da capire e da usa- 
re, ìl che rende meno arduo e faticoso il 
compito del programmatore, anche se a 
costo di qualche rinuncia sul piano della 
velocità del programma. 

Negli ultimi anni quanti si occupano di 
mìcroprogrammazione hanno cercato dì 
creare analoghi programmi di traduzione 
per il microcodice. Nel nostro caso il pro- 
blema è più difficile, perché le microistru- 
zioni potenziali sono molto più numerose 
delle comuni macroistruzioni. Un elabo- 
ratore microprogrammato può avere 50 
fili di controllo: ogni filo può assumere 
due stati diversi (on oppure off), e quindi 
il numero di tutte le possibili microistru- 
zioni sarebbe 2 S0 , cioè all'incirca 10 ls . 
Inoltre, poiché la velocità del micropro- 
gramma determina la velocità del calcola- 
tore, la richiesta di efficienza è molto più 
pressante. Il risultato è stata l'invenzione 
di linguaggi di microprogrammazione di 
alto livello, studiati con l'obiettivo di un 
equilibrio fra facilità di microprogram- 
mazione ed efficienza. Gli sviluppi recenti 
sono stati incoraggianti, ma una accetta- 
zione generalizzata fra quanti praticano la 
microprogrammazione sarà possìbile solo 
tra vari anni. 

Nel frattempo ricercatori al Thomas 
J. Watson Research Center della IBM e i 
mici colleghi e io al dipartimento di inge- 
gnerìa elettromeccanica e scienza del cal- 
colatore all'Università della California a 
Berkeley abbiamo seguito una diversa 
impostazione. Partiamo scartando il tra- 
dizionale insieme di macroistruzioni. 
quindi scriviamo nuovi programmi che 
traducono i linguaggi di programmazione 
standard di alto livello direttamente in 
microcodice. Le macchine basate su que- 
sto principio sono chiamate genericamen- 
te calcolatori a insieme ridotto di istru- 
zioni (reduced-instruaion-sei computer, o 
RISC). Per mettere alla prova le nostre 
idee, a Berkeley abbiamo progettato un 
nostro microelaboratore, che chiamiamo 
Risc 1. Inoltre abbiamo semplificato il 
passo della traduzione codificando le mi- 
croistruzioni in modo massimale per ot- 
tenere un tipo di microprogramma ad 
andamento estremamente verticale. In 
effetti, tulli i programmi allora diventano 
microprogrammi. 

Prove effettuate recentemente da] no- 
stro gruppo e da ricercatori della IBM 
hanno dimostrato che per motte applica- 
zioni un calcolatore a insieme ridotto di 
istruzioni sarebbe da tre a cinque volte 
più veloce di un tradizionale calcolatore 
a insieme complesso di istruzioni. Ricer- 
catori della Stanford University e di vari 
laboratori industriali hanno dato l'avvio 
a progetti per lo studio di questa impo- 
stazione. Se i dati preliminari saranno 
confermati, potrà emergere un calcolato- 
re di tipo più semplice, che rappresenterà 
un inatteso passo avanti nel progressivo 
sfruttamento del principio della micro- 
programmazione. 



40 



I fononi 



Come ì fotoni sono i «quanti di luce», così i fononi sono i «quanti 

di suono», entità descrittive astratte alle quali si può ricorrere 

per determinare le proprietà meccaniche, ottiche e termiche dei solidi 

di Raffaele Guido Della Valle e Pier Francesco Fracassi 



In meccanica classica il termine «parti- 
cella» denota un oggetto fisico dota- 
to di individualità e descrivibile col 
modello del punto materiale: gli attri- 
buiamo, cioè, una posizione (caratteristi- 
ca geometrica), una massa (caratteristica 
statica) e un impulso (caratteristica dina- 
mica). Con l'avvento della meccanica 
quantistica e il contemporaneo sviluppo 
dell'indagine sperimentale nel mondo 
microscopico, il significato del termine 
«particella» si è progressivamente allon- 
tanato dall'idea di «corpuscolo» che ori- 
ginariamente evocava. 

Principi quali la dualità onda-particel- 
la (Louis De Broglie) e il principio d'in- 
determinazione (Werner Heisenberg) 
non solo asseriscono la necessità di un 
diverso atteggiamento nel nostro modo 
di osservare e valutare i fenomeni su sca- 
la microscopica, ma ci indicano pure le 
proprietà fondamentali che caratterizza- 
no la «particella quantistica»: un'entità 
che ci descriva uno dei possibili modi 
d'essere dell'energia, unitamente alla sua 
possibilità di trasporto. 

Se generalmente oggi il termine parti- 
cella evoca l'universo dei fenomeni sub- 
nucleari (e delle cosiddette «particelle 
elementari»), la fisica dei solidi ha adot- 
tato e sviluppato in modo suo peculiare ìl 
concetto di «particella quantistica», inte- 
sa quale «eccitazione elementare di un 
mezzo». La più nota particella di tale 
tipo è il fotone, l'eccitazione elementare 
del campo elettromagnetico, responsabi- 
le non solo della propagazione della ra- 
diazione luminosa, ma pure di tutte le 
interazioni tra cariche elettriche e mo- 
menti magnetici. 

Il fonone fu la prima eccitazione ele- 
mentare in un solido a essere trattata 
formalmente, con i lavori pionieristici di 
Max Born e Theodor von Karman del 
1912, nei quali vennero gettate le basi di 
una teoria dinamica e quantistica dei soli- 
di cristallini (il nome «fonone», o «quan- 
to di suono», venne coniato per analogia, 
anche etimologica, con «fotone», o 
«quanto di luce»). In meccanica classica è 
noto che, se un sistema di corpi in equili- 
brio stabile viene in qualche modo distur- 



bato, il sistema compie vibrazioni attorno 
a tali posizioni di equilibrio, e il disturbo si 
propaga delocalizzandosi sull'intero si- 
stema. Tanto più intense sono le intera- 
zioni tra i costituenti del sistema, tanto 
più veloce sarà tale processo di propaga- 
zione (si pensi, per esempio, a un reticolo 
di palline unite da molle). 

Un solido reale, inteso quale sistema di 
nuclei e di elettroni, obbedisce, nella sua 
struttura microscopica, alle leggi della 
meccanica quantistica, ma la sua risposta 
a disturbi esterni è del tutto analoga: si 
produce un'eccitazione collettiva deloca- 
lizzata, le cui proprietà sono interamente 
detcrminate dalla struttura geometrica 
del solido e dalle forze d'interazione che 
si manifestano al suo interno. 

Allorché tale eccitazione elementare 
coinvolge principalmente il moto dei nu- 
clei, viene detta «fonone»: l'unità fonda- 
mentale di cui sono costituiti tutti i pro- 
cessi elastici e acustici, e buona parte di 
quelli termici e ottici, che si producono 
all'interno dei solidi. 

La definizione più semplice che si può 
J dare di «solido» è quella di un insie- 
me di atomi o molecole, uniti da forze 
coesive e localizzati attorno a posizioni 
d'equilibrio. 

I solidi cristallini si distinguono dagli 
altri stati della materia per la periodicità 
con cui si organizzano tali posizioni d'e- 
quilibrio. Lo spazio all'interno di un cri- 
stallo può essere immaginato come sud- 
diviso in tante unità identiche a forma di 
parallelepipedo: tali unità sono dette 
«celle unitarie», e l'intera struttura «reti- 
colo cristallino». All'interno di ogni cella 
unitaria si trova un ugual numero di ato- 
mi, ciascuno localizzato attorno a uguali 
posizioni rispetto alla cella. 

Se immaginiamo una ripetizione infini- 
ta di tali unità elementari, così da riem- 
pirne omogeneamente lo spazio, avremo 
che le proprietà geometriche e fisiche di 
ciascuna cella saranno identiche a quelle 
di una qualunque altra. È tale caratteristi- 
ca che ci consente di affrontare il proble- 
ma della descrizione microscopica di tali 
materiali: la periodicità delle celle unita- 



rie ci garantisce che pure le proprietà di- 
namiche (e non solo quelle statiche) si 
ripresentino all'interno del cristallo con 
analoghe reanhirità. 

Ovviamente un cristallo reale si disco- 
sta da tale modello ideale: le sue dimen- 
sioni sono Finite, e sono sempre presenti 
imperfezioni geometriche e impurità 
chimiche che ne alterano la periodicità. 
Ma, se le dimensioni del cristallo sono 
grandi rispetto a quelle della cella unitaria 
(e il volume tipico di tali celle è inferiore a 
IO' 21 centimetri cubi) e se le imperfezioni 
sono sufficientemente «diluite» in un 
ambiente prevalentemente regolare, saia 
possibile descrivere il solido reale e le sue 
proprietà facendo uso del modello perfet- 
to e infinito; la finitezza dei campioni reali 
e le loro imperfezioni si riveleranno, nella 
maggior parte dei casi, inessenziali. 

Le proprietà fisiche dei solidi in genera- 
le, e dei cristalli in particolare, non sono 
determinate unicamente dalle loro carat- 
teristiche geometriche. Un ruolo essen- 
ziale è svolto dai meccanismi coesivi che 
regolano la dinamica degli atomi e, quin- 
di, determinano tutte quelle proprietà ma- 
croscopiche quali la conduzione termica 
ed elettrica, il calore specifico, le caralteri- 
stice ottiche e magnetiche, ecosì via. In base 
alla meccanica quantistica, come il legame 
chimico nelle molecole, cosi ì meccanismi 
coesivi nei solidi sono interamente dovuti a 
interazioni di natura elettromagnetica tra 
nuclei ed elettroni. 

Due sono le difficoltà che si oppongono 
alla trattazione diretta di tali interazioni: 
la prima, dovuta all'elevatissimo numero 
di nuclei e di elettroni in gioco; l'altra, 
concettualmente più profonda, dovuta al 
fatto che nuclei ed elettroni sono oggetti 
quantistici e non classici. Una descrizione 
che possa essere messa in corrispondenza 
con un modello classico costituirebbe, se 
giustificata, una potente guida per lo stu- 
dio di tali sistemi. 

È, dunque, possibile descrivere la di- 
namica dei nuclei in termini di «oscilla- 
zioni attorno all'equilibrio» trascurando i 
dettagli della dinamica elettronica? 

Max Born e Robert Oppenheimer det- 
tero, nel 1927. una risposta positiva a tale 



domanda, con la loro «ipotesi adiabatica» 
del moto nucleare: l'idea essenziale è che, 
tanto nelle molecole quanto nei solidi, i 
nuclei atomici, di massa notevolmente 
superiore a quella degli elettroni (un solo 
protone ha una massa 1018 volte quella 
dell'elettrone), si muovano molto più len- 
tamente di questi ultimi, cosicché il siste- 
ma di elettroni può riadattarsi istante per 
istante a ogni alterazione delle posizioni 
nucleari, senza esser costretto a compiere 
transizioni brusche e improvvise. 

Detto in termini più rigorosi, la dinami- 
ca dei nuclei coinvolge scale dei tempi più 
lunghe di quelle coinvolte dalla dinamica 
elettronica e, se l'ipotesi adiabatica risulta 
essere un'ipotesi realistica, sarà possibile 
descrìvere la dinamica nucleare come 
funzione delle coordinate dei soli nuclei. 

In effetti gli elettroni possono esser 
classificati grosso modo in due categorie; 
gli elettroni degli orbitali interni, forte- 
mente influenzati da un unico nucleo e a 
questo fortemente legati dall'attrazione 
coulombiana, sì da costituire con esso 
un sistema essenzialmente rigido detto 
«nocciolo atomico» (a tornii; core); e gli 
elettroni, più delocalizzati, degli orbitali 
estemi, che (come una nuvola di cariche 
mobilissime) influenzeranno con il loro 
campo medio il moto dei noccioli atomici . 

L'effetto su questi ultimi sarà rappre- 
sentabile come un «potenziale efficace» 
presente tra i vari noccioli atomici e di- 
pendente solo dalle loro coordinate. Il 
problema originario si è semplificalo, in 
quanto è stato ridotto il numero di coor- 
dinate che effettivamente descrìvono il 
sistema (sono state escluse le coordinate 
degli elettroni), ma è stato introdotto un 
nuovo tipo di incognita: la forma di que- 
sto «potenziale efficace» che guida il 
moto dei noccioli atomici. Evidentemen- 
te è la natura chimica del cristallo a de- 
terminarne la configurazione elettronica 
e, quindi, tale interazione efficace. 

Su tale base, si possono grosso modo 
distìnguere tre tipi principali di solidi cri- 
stallini: cristalli atomici o molecolari, in 
cui tutti gli elettroni sono localizzati at- 
torno a nuclei o gruppi molecolari ; cristal- 
li covalenti, dove parte degli elettroni 
sono delocalizzati sull'intero cristallo e 
distribuiti su bande di valenza; cristalli 
metallici, dove gli elettroni delocalizzati 
sono distribuiti su bande di conduzione e, 
quindi, presentano un'elevata mobilità. 

Una caratteristica fondamentale di- 
stingue la classe dei cristalli atomici o 
molecolari dalle altre due: gli elettroni dei 
cristalli atomici sono tutti contenuti entro 
orbitali (atomici o molecolari) saturati, 
poco influenzati dalla loro interazione col 
resto del cristallo. Nei solidi covalenti o 
metallici, invece, i costituenti non presen- 
tano orbitali saturi, cosicché, quando 
vengono uniti per formare il cristallo, gli 
orbitali elettronici esterni sono violente- 
mente alterati, producendo o tegami co- 
valenti distribuiti sull'intero reticolo 
(quarzo, tormalina, diamante), oppure un 
mare di elettroni quasi liberi (ìl «mare dì 
Fermi») tipico dei conduttori elettrici 
(rame, ferro, argento). 

La trattazione dei cristalli costituiti da 



ty : - = h 



o 



n 



r^ 7 



•h •# 1 **L •& 





Q° P< 




ck 



f 



Un cristallo ideale putì essere immaginato come suddiviso in tante celle identiche a forma di 
parallelepipedo, delte «celle unitarie». Ognuna di esse contiene un ugual numero di atomi, 
ciascuno localizzato attorno a uguali posizioni rispetto alla cella. L'ili nitrazione mostra la struttura 
cubica del cristallo di ammoniaca (NHj), dove in ogni cella sono contenute quattro molecole 
orientate secondo le quattro diagonali del cubo. Un cristallo del genere è detto «molecolare» in 
quanto le unita Mlj mantengono anche in fase solida la loro individualità: i tre idrogeni (come nel 
gas) sono uniti da legami covalenti all'atomo di azoto, mentre le interazioni Ira molecole diverse, 
ben più deboli, sono di tipo elettrostatico. Molecole adiacenti sono connesse anche da legami a 
idrogeno. Questa gerarchia di forze si manifesta nella presenza di due tipi distinti di modi di vibra- 
zione: «interni» li ti tiata frequenza, in cui i legami covalenti sono deformati) ed «estemi» (di 
frequenze tipicamente più basse, che corrispondono a traslazioni e librazioni rigide delle molecole). 




Una molecola con \ atomi possiede 3.Y mudi indipendenti dì molo (gradi di liberta). Una molecola 
bi atomica, come il monossido di carbonio CO, presenta Ire traslazioni rigide ortogonali tra loro fa, 
b,c), due rotazioni ortogonali all'asse molecolare (<f, e), e infine un modo di stiramento lungo l'asse 
f/). Lo stiramento è detto «modo intemo» perche, a differenza degli altri, deforma la molecola. 



50 



51 



unità saturate è generalmente più sempli- 
ce: l'energia d'interazione è prevalente- 
mente di natura elettrostatica e i suoi 
aspetti non classici possono esser calcolati 
con i metodi della meccanica quantistica, 
cosicché la determinazione dì potenziali 



efficaci realistici e, entro certi limiti, at- 
tendibili è facilitata. 

Se sono presenti unità ioniche (come ac- 
cade nei cristalli di cloruro di potassio, 
K + C1". o di nitrito di sodio, Na + NO~ 2 ) 
l'interazione prevalente è a lungo raggio, 



O O O o o o 
O O O O t) T) 







(3 O O o e o 



O 








o o 







o o 



o 



o 








Quando la periodicità di un cristallo all'equilibrio fin alto) -viene alterata da una deformazione, 
si producono al suo interno forze di richiamo che instaurano vibrazioni collettive di tipo on- 
dulatorio degli atomi. In un cristallo monoatomico si osservano due soli tipi di onde: onde 
longitudinali di compressione e rarefazione (al centro), nelle quali il movimento oscillatorio 
degli atomi è parallelo alla direzione di propagazione dell'onda, e onde trasversali (in basso), 
tipiche dei solidi, dove invece il moto degli atomi è ortogonale alla direzione di propagazione. 



di tipo colombiano. Nel caso di moleco- 
le elettricamente neutre, saranno le di- 
somogeneità nella distribuzione interna 
delle cariche a determinare forze elettro- 
statiche a medio raggio (aequa, ammo- 
niaca, benzene). 

Per quanto riguarda, infine, i solidi di 
gas nobile, la stabilità chimica delle unità 
atomiche consente unicamente forze 
debolissime a corto raggio (dette «di van 
der Waals») originate dalle fluttuazioni 
delle nuvole elettroniche e da fenomeni, 
tipicamente quantistici, di scambio elet- 
tronico. 

A questo punto introduciamo un ma- 
** dello teorico che permette di risolve- 
re con relativa facilità il problema dei 
moto dei noccioli atomici. Consideriamo 
una molecola biatomica: questa può esse- 
re descritta come composta da due noc- 
cioli atomici uniti da una forza dipenden- 
te dalla loro interdistanza e che rappre- 
senta il legame covalente. Tale molecola 
presenta sei gradi di libertà. Può, cioè, 
traslare rigidamente in tre direzioni orto- 
gonali (x, v, z), ruotare attorno ai due assi 
ortogonali all'asse molecolare (ossia al- 
l'asse passante per i due nuclei) e vibrare 
parallelamente a quest'ultimo. 

L'esistenza di una distanza d'equilibrio 
tra i due noccioli atomici significa che, se 
questi si avvicinano, si produrrà tra loro 
una forza repulsiva (e, viceversa, attratti- 
va se si allontanano) con il risultato che 
nella molecola potranno instaurarsi vi- 
brazioni caratterizzate dalla forza coesiva 
del legame covalente. 

Le leggi secondo cui tale forza varia con 
la distanza sono, in genere, molto com- 
plesse; ma. se l'ampiezza delle oscillazio- 
ni è piccola, tale forza risulta essere sem- 
plicemente proporzionale alla variazione 
d dell'interdistanza, ossìa F = -kd, dove 
la costante k (che esprime l'intensità del 
legame covalente) dipende dalla natura 
dei due atomi coinvolti e il segno meno è 
per esprimere che con d positivo (allen- 
tamento degli atomi) F è negativa (ossia 
tendente a riavvicinarli), e viceversa. Un 
sistema meccanico che sì comporti in tale 
modo è detto «oscillatore armonico», e 
una molecola biatomica, allorché compie 
piccole oscillazioni, è con buona appros- 
simazione un oscillatore armonico. 

Se i due noccioli atomici obbedissero 
alle leggi della meccanica classica (come 
due palline unite da una molla), il moto 
periodico avrebbe frequenza y = Vk~ e 
sarebbe realizzabile qualunque ampiezza 
(e. quindi, qualunque energia) d'oscilla- 
zione. La natura quantistica degli atomi, 
invece, impone delle limitazioni, e preci- 
samente sono attuabili solo quegli stati 
per cui l'energia sia un multiplo intero di 
/»', dove/t = 6,62 x IO" 27 erg al secondo 
è la costante di Planck. Quando la mole- 
cola è in uno di questi stati stazionari, gli 
elettroni seguono adiabaticamente (cioè 
senza compiere transizioni brusche) il 
moto dei nuclei. 

La molecola può passare da uno stato 
stazionario a un altro con un salto quan- 
tico, scambiando con l'esterno frazioni 
d'energia pari a multipli interi di/iv; per 



esempio, in un gas ciò può accadere 
come conseguenza di un urto con un'al- 
tra molecola. 

Allorché a tale moto vibratorio si asso- 
cia uno spostamento in controfase di cari- 
che elettriche di segno opposto (come 
accade, per esempio, nella molecola di 
monossido dì carbonio, CO. dove, per la 
maggior elettronegatività dell'ossigeno 
rispetto al carbonio, esiste un addensa- 
mento di carica negativa attorno al nucleo 
d'ossigeno e positiva attorno a quello di 
carbonio), la vibrazione può interagire 
con il campo della radiazione elettroma- 
gnetica: la molecola può, cioè, irradiare 
emettendo un fotone di frequenza v ed 
energia hv. oppure può aumentare it suo 
stato vibrazionale assorbendo un fotone 
di ugual frequenza ed energia. 

Del tutto analoga è la situazione nel 
caso di molecole poliatomiche: per picco- 
le oscillazioni è valida l'approssimazione 
armonica (ossia le forze di richiamo che si 
producono a seguito di deformazioni 
sono proporzionali alle deformazioni 
stesse); e, se a tali deformazioni si asso- 
ciano spostamenti di cariche elettriche, le 
vibrazioni potranno «accoppiarsi» al 
campo elettromagnetico della radiazione: 
la molecola potrà assorbire o emettere 
fotoni effettuando una transizione tra due 
diversi stati vi b razionali. 

Il maggior numero di nuclei determi- 
na un maggior numero di «modi di vi- 
brazione» possibili, caratterizzati da fre- 
quenze distinte associate a modi distinti 
di deformazione della molecola: se la 
molecola contiene N atomi, saranno 
possibili 3/V modi di moto. 

Caratteristica di tali vibrazioni armoni- 
che è la loro indipendenza reciproca: lo 
stato dì vibrazione a frequenza v' , ad 
esempio, non influenza il moto a frequen- 
za v", e può coesistere con esso. 

Allorché tale metodologia è applicata 
•**■ a un sistema cristallino, viene af- 
frontato uno dei temi principali della fisi- 
ca dei solidi: la «dinamica reticolare». 

Anticipata dai lavori sulla teoria quan- 
tistica dei calori specifici di Albert Ein- 
stein (1907) e di Peter Debye (1912), la 
dinamica reticolare venne affrontata per 
la prima volta da Max Boni e Theodor 
von Karman nel 1912, ma il suo vero 
contenuto fisico non fu pienamente com- 
preso per più di treni anni, e solo nel ! 954 
la teoria raggiunse la sua prima maturità 
con il trattato di Max Born e Kun Huang 
Dynamical Theory of Crystat Lattices. 

Se supponiamo che le forze agenti tra i 
noccioli atomici dì un cristallo siano di 
natura armonica, anche in tale struttura si 
realizzeranno movimenti oscillatori indi- 
pendenti l'uno dall'altro. 

Se il reticolo di un cristallo macrosco- 
pico è costituito da N atomi, i modi di- 
stinti dì moto saranno, come per le mole- 
cole, 3N; unica differenza è che, adesso, 
N è tipicamente un numero dell'ordine di 
IO 23 (ossia del numero di Avogadro): il 
calcolo delle frequenze e dei modi par- 
rebbe impraticabile, dovendo esser risol- 
te IO 2 - 1 equazioni di moto! 

Fortunatamente la struttura periodica 



5 x io" — 



4 x 10" — 



3 x 10" 



_J 

< 
z 



a 

LU 

ce 



2 x 10" 



• l • 



1 x 10 IJ - 





C[4.H 10 
ASTRACENE 



0,5 
VETTORE D'ONDA K 



L 



La dinamica reticolare di Max Born ebbe una convincente conferma sperimentale nel 1955, 
quando le prime esperienze di spettroscopia a neutroni, condotte da B. N. Brockhouse a ChaJk 
River, in Canada, mostrarono l'esistenza dei fononi e la dipendenza della loro frequenza dal 
vettore d'onda. ÌSel grafico sono riportale le frequenze, in funzione dei vettore d'onda, dei modi 
normali del cristallo molecolare di aniracene. t valori sperimentali (pallini) sono stati misurati 
con spettroscopia a neutroni da I. Natkaniec a Dubna, in Unione Sovietica, mentri- le curve teo- 
riche sono state calcolate dagli autori. Le tre curve inferiori (in colore) corrispondono ai modi 
acustici (traslazioni rigide delle molecole), mentre le altre corrispondono ai modi ottici. Questi 
ultimi sono complesse combinazioni di librazioni, traslazioni e deformazioni delle molecole. 



del cristallo permette semplificazioni de- 
cisive: difatti ciascuna cella, identica a tut- 
te le altre, presenta gli stessi movimenti 
possibili (alle medesime frequenze) di 
una qualunque altra cella. Ciò farà sì che 
lo stato dinamico di una cella sì propaghi, 
identico, alle celle vicine: le oscillazioni 
del cristallo nel suo insieme si potranno 
descrivere in termini di onde elastiche. 



Sarà sufficiente risolvere le equazioni di 
moto per un'unica cella, e il moto delle 
altre potrà essere dedotto con semplici 
considerazioni geometriche. 

Per comprendere, almeno qualitativa- 
mente, i moti oscillatori che hanno luogo 
in un solido cristallino, immaginiamo che 
cosa accade a una molecola (ad esempio il 
monossido di carbonio. CO) quando en- 



52 



53 









Gì 


— 0,14 x 10" 






s 








ce 
m 

a. 








ISJ 

K 
[E 
HI 

X 










E 

ni 

0. 












5 




II 






















I 


u 


b 




| 








lU 

a 


- A 




i 


\r 


■ 


\ 


\ 






_^r^ I 


i 


i 


j_ 


VJ 








3 0,5 x 10" 1 X 10" 1,5 x 10" 




FREQUENZA (HERTZ) 



II numera di mudi normali presenti in un cristallo macroscopico è dell'ordine del numero 
d'Avogadro. Come si distribuiscono in frequenze tali modi normali? La loro distriti uzione, 
detta «densità di stati», non obbedisce a una legge generale, bensì è determinala dalla struttura 
geometrica e dai potenziali d'interazione caratteristici di ogni particolare cristallo. L'illustra- 
zione mostra la densità di stali calcolata dagli autori per i modi esterni di librazione e trasla- 
zione del cristallo di ammoniaca: in ascissa vi sono le frequenze, in ordinata il corrispondente 
numero di modi normali. 1 modi interni, non rappresentali, sono tutti situati a frequenze net- 
tamente più alte (maggiori di 3,6 x 10' •' hertz). Tate separazione tra le frequenze dei modi 
esterni e quelle dei modi interni è conseguenza del Tatto che i legami covalenti all'interno delle 
molecole sono estremamente più rigidi dei legumi, di natura prevalentemente elettrostatica, 
tra molecole diverse. La densità di slati di un cristallo determina tutte le proprietà termodina- 
miche, come i calori specifici, le energie di sublimazione, le variazioni d'entropia, e cosi via. 



tra a far parte di un retìcolo. Come si è 
detto, la molecola biatomica libera nel gas 
presenta sei tipi indipendenti di movi- 
mento: tre traslazioni, due rotazioni e una 
vibrazione interna di stiramento. 

Nel gas le velocità sono in genere così 
elevate, e la densità cosi bassa, che due 
molecole possono influenzare reciproca- 
mente i loro moti solo nell'eventualità di 
urti. In un reticolo cristallino (e, in gene- 
re, in ogni fase condensata) le ridotte ve- 
locità e la contiguità di più molecole ren- 
dono le mutue interazioni (nel nostro 
caso di tipo prevalentemente elettrostati- 
co) capaci di influenzare continuamente i 
moti molecolari; gli originali moti di tra- 
slazione saranno limitati a oscillazioni ri- 
gide dell'intera molecola, producendo 
(nel loro propagarsi) tre onde di compres- 
sione e rarefazione (una longitudinale, 
come nei fluidi, e due trasversali tipiche 
dei solidi); le rotazioni degenereranno in 
moti di «beccheggio» (librazioni) delle 
molecole attorno a orientazioni di equili- 
brio; lo stiramento, infine, conserverà più 
degli altri modi le proprie caratteristiche, 
con la condizione, però, di non poter più 
interessare un'unica molecola, ma di 
comunicarsi all'intero sistema. Quelli che 
erano sei gradi di libertà nella molecola 



libera di CO sono divenuti sei tipi distinti 
di onde elastiche nel rispettivo cristallo. 

L'ipotesi armonica, che garantisce l'in- 
dipendenza di oscillazioni distinte, ci 
permette di trattare tali onde come non 
interagenti e, quindi, di esaminarle indi- 
vidualmente. 

La presenza di un'onda elastica denota 
l'esistenza di deformazioni del reticolo 
periodiche nel tempo e nello spazio. Cia- 
scuna onda è caratterizzata da una fre- 
quenza e e da un vettore d'ondai-, cioè un 
vettore avente per direzione quella di 
propagazione e per modulo il reciproco 
della lunghezza d'onda. Ciascuna di que- 
ste onde elastiche indipendenti, ossia cia- 
scuno di questi movimenti collettivi inte- 
ressanti l'intero cristallo, è detto «modo 
normale» di vibrazione. 

A causa della disomogeneità e aniso- 
tropia di ogni retìcolo cristallino, la fre- 
quenza di tali modi normali dipenderà 
non solo dal tipo di deformazione perio- 
dica considerata, ma anche dalla sua lun- 
ghezza d'onda e dalla direzione di propa- 
gazione, ossia dal vettore d'onda k. Il 
numero possibile di modi dipende dalla 
struttura della cella unitaria e in generale, 
se m è il numero di atomi per cella, vi 
saranno 3m modi normali distinti per ogni 



vettore d'onda (per esempio, l'ammonia- 
ca, NH 3 , che cristallizza in un reticolo 
cubico con quattro molecole per cella, 
presenta 48 modi distinti), ma comuni a 
tutte le strutture sono i tre modi di com- 
pressione e rarefazione detti * acustici» e 
caratterizzati da traslazioni rigide in fase 
di tutti gli atomi appartenenti alla mede- 
sima cella unitaria. 

I modi acustici a grande lunghezza 
d'onda sono sempre a bassa frequenza e 
determinano le proprietà acustiche e 
quelle elastiche quasi-statiehe (come la 
comprimibilità) del materiale. Gii altri 
modi (librazioni, vibrazioni interne mole- 
colari e traslazioni in controfase) sono 
detti «ottici». 

II significato di tale denominazione 
appare chiaro se si considera che per tali 
modi, a differenza dei modi acustici, è 
possibile l'instaurarsi di vibrazioni in con- 
trofase di cariche elettriche di segno op- 
posto, con la conseguente capacità d'inte- 
razione con il campo elettromagnetico 
della radiazione. 

"pinora abbiamo trascurato la natura 
-T quantistica del cristallo. In realtà per 
ogni modo normale non sono permesse 
tutte le energie, come accadrebbe in un 
sistema classico, hensì per ogni frequenza 
V si potranno realizzare solo le oscillazioni 
per cui l'energia è un multiplo intero di 
hv, Abbiamo anche visto come, per cia- 
scun modo, la frequenza cambi al variare 
del vettore d'ondai (ossia al variare della 
lunghezza d'onda e della direzione di 
propagazione). 

Lo stato dinamico complessivo de! cri- 
stallo sarà determinato completamente 
allorché, per ogni modo di frequenza v, 
sarà specificato (con un numero intero?») 
il livello a cui esso è eccitato. Tale numero 
n è detto «numero d'occupazione», e il 
rispettivo modo avrà un'energia pari a /> 
volte hv. 

Ciascuna dì queste unità hv d'eccita- 
zione vibrazionale del reticolo cristallini» 
è detta «fonone» e quindi lo stato dina- 
mico di un cristallo si esprime fornendo 
il numero d'occupazione (ossia, il nume- 
ro di fononi presenti) per ciascun modo 
del reticolo. 

Come si vede, all'origine del concetto 
di fonone vi è essenzialmente un'astra- 
zione matematica, giustificata unicamen- 
te dalla natura delle soluzioni trovate al 
problema della dinamica reticolare. 

L'entità che è stata chiamata «fonone» 
(e lo stesso si potrebbe ripetere per altre 
eccitazioni elementari, quali sono i fotoni 
per il campo elettromagnetico, o gli ecci- 
toni, i plasmoni, i maglioni nei solidi) e in 
primo luogo un «elemento descrittivo» 
suggerito dai modello astratto con cui si 
rappresenta un mezzo fisico reale e con 
cui si cerca di descrivere le proprietà os- 
servabili di quest'ultimo. A ogni fonone 
sono associate quelle capacità di traspor- 
to d'energia e di impulso, che si richiedo- 
no a una «particella quantistica» ; possia- 
mo, cioè, descrivere ciascun fonone come 
una «particella» dotata di energia hv e 
impulso hk. 

L'uso di tali particelle come entità 



SORGENTE 



wvvv^ 




www 



RILEVATORE 



A 



r/K 



-> 



T~ 



-> 



L'na misura spettroscopica d'assorbimento viene realizzala facendo at- 
traversare il cristallo da un fascio di fotoni emesso da una sorgente, 
mentre uno strumento di rilevamento osserva la radiazione uscente. Le 
proprietà della sorgente sono note, cosicché conosciamo l'intensità / 
della radiazione per ogni frequenza v incìdente sul cristallo. Il cristallo, 
interagendo con la radiazione, altera tale distribuzione iniziale d'inten- 
sità, producendo una distribuzione/" che viene misurata dal rilevatore. 
Il rapporto tra le due distribuzioni (lo «spettro») contiene, ovviamente, 
informazioni circa le proprietà del cristallo. Tali informazioni possono 



dotate, in qualche modo, di una realtà 
oggettiva viene reso legittimo dal fatto 
che, nel comportamento collettivo dì tali 
eccitazioni elementari, si ritrovano quei 
fenomeni che si osservano sperimental- 
mente nei solidi. 



essere decodificate solo disponendo di un modello teorico che descriva 
il solido e le sue modalità d'interazione con la radiazione. Gli spettri 
normalmente osservati presentano bande o picchi di assorbimento di 
larghezze finite (in colore); U modello armonico, invece, prevede righe 
infinitamente sottili (in nero) in prossimità dei massimi dei picchi spe- 
rimentali. Solo modelli che tengano conto dell'anarmonicìtà (e quindi 
delle interazioni tra fononi) possono spiegare le larghezze finite e la 
forma delle bande osservale. In Ini senso la teoria anarmonica dei solidi 
cristallini è qualitativamente superiore a quella puramente armonica. 



Abbiamo visto come sia possibile, per il 
•**■ campo elettromagnetico, agire sulle 
componenti atomiche di un cristallo ecci- 
tandovi i modi ottici di vibrazione, ossia 
quei movimenti che presentano vibrazio- 
ni nella distribuzione di cariche elettriche 
di segno opposto. 

Se si vuole descrivere tutto ciò con il 
formalismo delle eccitazioni elementari, 
sì possono trattare i vari fenomeni fisici 
come sovra pposizio ni di processi più 
semplici, la cui rappresentazione è intui- 
tivamente più immediata. Difatti, il cam- 
po elettromagnetico della radiazione può 
essere descritto in termini di fotoni, che 
altro non sono se non le «particelle quan- 
tistiche» associate alle eccitazioni ele- 
mentari dei modi normali del campo: in 
completa analogia con un fonone, un fo- 
tone di frequenza v e vettore d'onda k 
trasporta un'energia hv e un impulso hk. 

Ne consegue che le complesse intera- 
zioni tra radiazione e cristallo possono 
essere riformulate in termini di interazio- 
ni tra fotoni e fononi, ossia possono essere 
analizzate in processi elementari nei quali 
alcune «particelle» sono create e altre di- 
strutte, conservando l'energia e l'impulso 
complessivi. L'assorbimento di radiazio- 
ne, nella sua descrizione microscopica, 
risulta un processo in cui un fotone viene 
distrutto e viene creata nel cristallo una 
sua eccitazione elementare. 

Tre sono le condizioni da soddisfare 
affinché tale processo abbia luogo: con- 
servazione dell'energia; conservazione 
dell'impulso; possibilità d'accoppiamen- 









a 










f 














a 








fi 












a 


(J 


a 






b 








fi 












a 


1 


s ^\ 


i 


a 




e 






\ 


Y 


r 









I diagrammi di Feynman sono un potente ausilio per la fisica teorica delle particelle elementari e 
dello stato solido. Benché la loro struttura grafica evochi l'idea di traiettorie e collisioni, ciascun 
diagramma e. in realtà, la rappresentazione di un'espressione matematica ben definita, esprìmente la 
probabilità che a un determinato stato iniziale (rappresentato dalle linee che «entrano» nel dia- 
gramma) consegua un particolare altro stato finale (rappresentato dalle linee che «escono» dal 
diagramma): ciascuna linea è associata a un'eccitazione elementare del sistema, e ciascun vertice 
i [Hindi d'incontro di più linee) rappresenta le loro interazioni possibili. Regote ben precise permet- 
tono, poi, di dedurre da i>gni configu razione un'appropriata espressione algebrica. La propaga- 
zione «libera» di un fonone (cioè in assenza di interazioni con altri fononi) è rappresentata dal 
diagramma a, cui corrisponde la descrizione (espressa in termini di correlazioni di probabilità) di 
come il fonone fi si propaghi dall'Istante i all'istante t' . Se si introduce l'interazione tra fotoni, alla 
probabilità della propagazione libera va aggiunta quella dovuta all'eventualità di processi di tipo h 
i diffusione elastica del fonone >r dovuta al fonone/i) e di tìpoc (dove la propagazione» è «interrotta» 
dal prodursi di una coppia «virtuale»/? e ;) e quindi da processi via via più improbabili descrìtti da 
diagrammi sempre più complessi. Processi del tipo b allenino la frequenza del fonone «, mentre 
processi del tipo e rendono finita la sua vita media. L'efficacia di tali processi è determinata dai 
potenziali d'interazione all'interno del cristallo e dalla sua temperatura; calcoli numerici completi di 
tali etici ti si sono resi possibili solo recentemente e richiedono l'uso di calcolatori molto veloci. 



54 



55 



wvww 



WWW\ b 




WW\AA 




\AAAAAAr*- 



Vv 



I diagrammi di Feynman possono essere impiegati pure per descrive- 
re le interazioni tra fotoni (linee ondulale) e fononi {linee diritte). 
Allorché un fotone a è risonante con un fonone f) (ovvero ha la 
medesima frequenza e il medesimo vettore d'onda), potranno pro- 
dursi processi d'assorbimento (a) o processi inversi di emissione (b). 
Un fotone non risonante può essere ugualmente assorbito dal cristal- 
lo tramite processi muttifonuntei: il diagramma e rappresenta il pro- 
cesso in cui il fotone a crea direttamente due fononi j) e y di energia 
e impulso complessivi uguali a quelli del fotone distrutto. La proba- 
bilità che un tale evento si verifichi è spesso esigua; molto più effica- 
ce è il processo indiretto (d) in cui il fotone crea un fonone virtuale 
, ■ a energia diversa dalla propria: simili violazioni delta conservazio- 
ne dell'energia sono consentite nei sistemi quantistici, ma solo per 



tempi estremamente brevi; il fonone virtuale decade immediatamente 
in due fononi y e 1) con energia e impulso complessivi uguali a quelli 
del fotone iniziale. Ciascuna di tali transizioni, presa singolarmente, 
non ha elevata probabilità, ma, poiché il numero di transizioni possibi- 
li con uguale stato finale è elevatissimo, il processo complessivo è 
mollo efficace. Il diagramma e, infine, rappresenta la diffusione anela- 
stica (scattering Raman) della radiazione, in cui la frequenza del foto- 
ne incidente a e diversa da quella del folone riemesso a'. L'energia 
mancante e dovuta alla contemporanea eccitazione di un fonone ri 
tramile due fononi virtuali /i e ;'. Tale fenomeno è sfruttato nella 
cosiddetta «spettroscopia Raman» per la misura sperimentale delle 
frequenze dei fononi (in alternativa a misure di spettri d'assorbimen- 
to), utilizzando sorgenti di radiazione laser per il fotone incidente a. 



to. La prima condizione impone che la 
frequenza de ir eccitazione elementare 
prodotta sia la stessa del fotone distrutto; 
le frequenze tipiche dei fononi vanno da 
10 ID a IO 14 hertz, quindi l'interazione 
d'assorbimento è limitata ai fotoni dell'in- 
frarosso e dell'infrarosso lontano. Poiché 
la velocità di propagazione dei fotoni è 
quella della luce (3 x IO 10 centimetri al 
secondo), le loro lunghezze d'onda sa- 
ranno molto superiori alle dimensioni del- 
le celle unitarie, ovvero Ì vettori d'onda 
saranno molto piccoli. L'impulso traspor- 
tatola un'eccitazione di vettore d'ondai 
e hk e, quindi, per la conservazione del- 
l'impulso, solo quei pochi fononi con pic- 
colo vettore d'onda potranno interagire 
con i fotoni. 

Come avviene l'interazione nei casi 
permessi? Diamone prima una descrizio- 
ne ondulatoria. Come abbiamo visto, i 
modi ottici del cristallo sono vibrazioni 
caratterizzate da campi elettrici e magne- 
tici oscillanti prodotti dalle cariche stesse 
del reticolo. Allorché giunge un'onda 
elettromagnetica, questa perturberà il 



moto delle cariche e sarà da esse pertur- 
bata a sua volta, cosicché nel cristallo si 
propagherà un disturbo la cui energia è 
parte in forma elastica (come un fonone) 
e parte in forma elettromagnetica {come 
un fotone). Se la frequenza originaria del- 
la radiazione è lontana da ogni possibile 
frequenza reticolare, la componente 
«fononica» è assente (il cristallo è traspa- 
rente). Viceversa, se la frequenza è esat- 
tamente uguale a una frequenza ottica del 
reticolo (risonanza), la componente «fo- 
tonica» sarà nulla (il cristallo assorbe 
radiazione). 

Nei casi intermedi avremo dei modi 
«ibridi» elastici ed elettromagnetici al 
tempo stesso. Poiché pure ora valgono le 
regole di quantizzazione. tali modi ibridi 
possono trasportare solo quantità discre- 
te di energia del valore dì hi', se i' è la loro 
frequenza. Tali modi accoppiati non riso- 
nanti fonone-fotone sono detti «polarito- 
ni»; tanto più è grande la loro componen- 
te fotonica, tanto più la loro propagazione 
è di tipo ottico; se prevale la natura fono- 
nica, la loro propagazione è di tipo elasti- 



co e, al limite della perfetta risonanza, 
tutta l'energia elettromagnetica del foto- 
ne è convertita in energia elastica del reti- 
colo: si ha un processo di assorbimento. 
Esprimendo tutto ciò in termini di 
«particelle quantistiche», diciamo che i 
fotoni (ovvero il campo elettromagnetico 
di radiazione esterno al cristallo) possono 
decadere in eccitazioni elementari del so- 
lido: a seconda delle frequenze in giuoco, 
queste saranno fononi (eccitazioni pura- 
mente elastiche), polaritoni (eccitazioni 
ibride elastico-elettromagnetiche che rea- 
lizzano il campo di radiazione all'interno 
del cristallo), ovvero, per frequenze nel 
visibile e oltre, eccitazioni elettroniche 
collettive come gli cedroni e ì plasmoni. 

All'inizio degli anni cinquanta si svilup- 
**■ parono, a opera principalmente di 
Richard P. Feynman e Freeman J. Dyson, 
t metodi della meccanica quantistica dei 
campi, che permisero la prima trattazione 
teorica quantitativa delle particelle ele- 
mentari. Negli stessi anni, per merito 
principalmente di A. A, Abrikosov. L, P. 



Gorkov e della scuola russa, tali metodi 
vennero estesi alla meccanica statistica, 
rendendo possibile lo studio delle intera- 
zioni tra le eccitazioni elementari nei 
solidi. Ciò produsse, tra l'altro, una nuo- 
va esplosione d'interesse nei confronti 
della dinamica reticolare, e vennero ef- 
fettuati, da Alexei Maradudin, E, R. Cow- 
ley e collaboratori, i primi calcoli che 
tenessero conto della cosiddetta «intera- 
zione anarmonica» tra fononi. 

L'indipendenza dei modi normali di un 
cristallo si traduce nell'assenza di intera- 
zioni tra i vari fononi: allorché un fonone 
viene creato eccitando un modo norma- 
le, questo si manterrebbe indefinitamen- 
te qualunque sia lo stato dinamico del 
resto del cristallo. Tale indipendenza 
deriva unicamente da una semplificazio- 
ne formale che fu fatta all'inizio della 
trattazione: l'ipotesi armonica. L'ipotesi, 
cioè, che per piccole oscillazioni le forze 
di richiamo siano proporzionali alle de- 
formazioni del reticolo. 

Benché tale ipotesi sia sufficientemen- 
te accurata da fornire stime ragionevoli 
delle frequenze dei vari modi normali, la 
sua validità non è però assoluta; i termini 
«anarmonici» dell'interazione tra atomi e 
molecole (ossia tutte quelle componenti 
degli sforzi che non sono linearmente 
proporzionali alle deformazioni) produ- 
cono correzioni alla dinamica armonica, 
che si traducono in interazioni tra fononi. 
Si avranno, così, eventi in cui un fonone è 
distrutto e se ne creano due con energia e 
impulso complessivi uguali a quelli del 
fonone originario, processi inversi (in cui, 
cioè, due fononi sono distrutti e uno crea- 
to) e, poi, processi via via più improbabili 
che coinvolgono un numero sempre mag- 
giore di fononi. 

La presenza di tali interazioni perturba 
l'evoluzione di ogni eccitazione elemen- 
tare, che è così influenzata dal continuo 
scambio di impulso e di energia tra i vari 
modi normali. Due sono gli effetti imme- 
diati: l'alterazione delta frequenza di ogni 
fonone, e l'introduzione di una possibilità 
di decadimento che ne rende finita la vita 
media. E così, mentre i! modello armoni- 
co prevedeva assorbimento della radia- 
zione unicamente a frequenze esattamen- 
te definite (con conseguenti spettri a righe 
infinitamente strette), le vite medie finite 
si rivelano, sia sperimentalmente che teo- 
ricamente, con righe d'assorbimento di 
larghezza finita. 

Solo negli ultimi anni una conoscenza 
più approfondita delle forze interatomi- 
che e intermolecolari, unita alta disponi- 
bilità di calcolatori molto veloci, ha reso 
possibile il calcolo teorico di tali effetti 
anche in cristalli complessi quali sono 
quelli molecolari. 

L'indagine teorica su tati materiali si 
sta rapidamente sviluppando, attraverso 
una vasta collaborazione su scala interna- 
zionale, che vede impegnati, tra gli altri, 
Maradudin, a Irvine, California; Michael 
Klein, al National Research Council di Ot- 
tawa; Stuart Pawley, a Edimburgo - , Stuart 
Walmsley. all'University College di Lon- 
dra: Salvatore Califano, a Firenze; Tadeusz 
Luty, a Cracovia; e i toro collaboratori. 



Sin qui non ci siamo chiesti quanti fono- 
ni popolino «normalmente» un cri- 
stallo. In effetti esiste una precisa relazio- 
ne tra il numero medio di fononi presenti 
in un solido in equilibrio termico e la sua 
temperatura T. "Tale relazione è stabilita, 
come per ì fotoni, dalle regole della stati- 
stica di Bose-Einstein. la quale asserisce 
che il numero medio n di fononi di fre- 
quenza è dato dalla relazione di Planck 
n = (exp(/iW&7*) - l)* 1 , dove k è la co- 
stante di Boltzmann pari a 1,38 x IO" 16 
erg/kelvin. 

Tale popolazione termica media dei 
fononi è detta «distribuzione di equili- 
brio». È evidente, quindi, il ruolo deter- 
minante che ha la temperatura del cri- 
stallo per tutti quei processi che coinvol- 
gono interazioni con i fononi; in partico- 
lare, temperature più elevate, ovvero 
popolazioni medie più grandi, aumenta- 
no la probabilità di decadimento delle 
eccitazioni elementari, riducendone la 
vita media. 

Allorché un disturbo esterno (per 
esempio, un fascio di fotoni) altera lie- 
vemente tale distribuzione d'equilibrio, 
creando o distruggendo alcuni fononi, il 
sistema tenderà a ritornare allo stato 
d'equilibrio termico attraverso i processi 
d'interazione fonone-fonone. Lo scam- 
bio d'energia tra il sistema e l'agente 
esterno verrà determinato da tale evolu- 
zione verso l'equilibrio, che sarà tanto 
più efficiente e veloce, quanto più inten- 
se sono te interazioni tra i fononi e quan- 
to più consistente è la popolazione d'e- 
quilibrio preesistente. 

L'osservazione sperimentale di un 
fonone (o, più in generale, di una qual- 
siasi eccitazione elementare in un solido) 
consiste, quindi, nell'alterazione della 
popolazione d'equilibrio e nella conse- 
guente risposta de! sistema. 

L'adozione di un modello corpuscola- 
re per ta descrizione di tali processi è sta- 
ta originata dall'evidenza sperimentale 
che un'eccitazione a frequenza v possa 
avvenire solo scambiando con t'esterno 
energia in multipli di hv. 

La legittimità con cui può essere a- 
dottata una descrizione corpuscolare non 
è però garantita a priori: il cristallo, come 
qualunque altro stato della materia, pre- 
senta solo delle «modalità d'interazione» 
con l'esterno, oggettive in quanto osser- 
vabili e riproducibili. Riteniamo che tali 
«modalità d'interazione» siano descrivi- 
bili in termini di eccitazioni elementari. 

Se, con il comportamento di tali ecci- 
tazioni elementari, riusciremo a descri- 
vere fenomeni effettivamente osservabi- 
li, allora (e solo allora) sarà legittimo at- 
tribuire una realtà oggettiva al «fonone», 
o a oggetti dall'esistenza spesso più effi- 
mera quali sono le tante «particelle» che 
si producono negli acceleratori. 

E comprensibile come tale modo di 
procedere possa indurre dubbi e diffi- 
denze nei «non addetti ai lavori». Ma ciò 
fa parte di quel processo in cui, all'am- 
pliarsi del campo dell'esperienza, t'idea 
che abbiamo del mondo, e il significato 
stesso delle parole che usiamo per de- 
scriverlo, mutano e, talora, si evolvono. 



PROBLEMI 

DEL 

TERZO MONDO 

l j ti ? I ... 1 Tj . 1 Z. tj adizione italiana ai 

SCI ENTI FIC AMERICAN 

ha dedicato all'argomento diversi 
articoli: 



LE POPOLAZIONI DEI PAESI 
IN VIA DI SVILUPPO 

di P Derrteny (n. 79) 

Queste popolazioni, che costituiscono 

quasi i Ire ijuarli delta specie umana, 

continueranno a crescere rapidamente nei 

prossimi decenni. È necessario accelerare 

il processo di autoregolazione. 



TECNOLOGIA E PAESI IN VIA 
Di SVILUPPO 

di G. Myrdat (n. 79) 

L'introduzione delle tecnologie moderiti 

nei paesi in via di sviluppo richiede 

notevoli adattamenti per la diversa 

situazione socioeconomica e culturali 

e per la diversa disponibilità 

dei fattori di produzione 



IL POTENZIAMENTO 

DELL'AGRICOLTURA NEI PAESI 

IN VIA DI SVILUPPO 

di W. D. Hopper (n. 104) 

/ paesi poveri potranno raggiungere 

l'autosufficienza alimentare se la loro 

agricoltura verrà modernizzata e la loro 

economia ristrutturata con il trasferimento 

di risorse tecniche e finanziarie dalle 

nazioni ricche. 



IL PIANO DI VALORIZZAZIONE 
DELLA VALLE DEL GIUBA 

di P. G. Cannata (n. 110) 

Questo piano, frutto di unii 

collaborazione internazionale, è un chiaro 

esempio di come te nuove strategie di 

sviluppo debbano tenere conto delle reali 

esigenze del paese in cui sono attuale 



LA LOTTA CONTRO L'EROSIONE 
DEL TERRENO IN NIGERIA 

di P. G. Cannata e D. Fanciullacci (11 155) 

Nella regione dell'ex Biafra. dovi 

l'ambiente tropicale è altamente degradali' 

e sovrappopolato, è in fase di 

realizzazione un progetto che utilizza 

contemporaneamente strumenti tecnici e 

dì recupero sociale. 



56 



57 



La memoria negli uccelli 
che fanno incetta di cibo 

Gli uccelli che nascondono semi per poi recuperarli sembrano avere 
un'eccellente memoria spaziale: la nocciolaia, per esempio, ricorda 
anche per diversi mesi dove ha immagazzinato migliaia di provviste 

di Sara J. Shettleworth 



In Inghilterra, in inverno, un distribu- 
tore dì cibo ripieno di noccioline è 
tutto quanto serve per poter osser- 
vare il comportamento degli uccelli e dal 
loro comportamento si può dedurre che 
questi animali hanno una notevole capa- 
cità di memoria, addirittura, sembra, di 
gran lunga superiore a quella di qualsia- 
si altro animale che sia stato osservato 
in laboratorio. Il distributore attrae mol- 
ti uccelli, tra ì quali cinciallegre, cincia- 
relle e cince bigie, tutte specie di piccole 
dimensioni e molto vivaci. Le cincialle- 
gre e le cinciarelle si affollano attorno al 
distributore, mangiando quanto più ra- 
pidamente possono. Interrompono il 
loro pasto solo per scacciare i loro con- 
correnti. Invece, una cincia bigia giunge 
come un fulmine, carpisce una noccioli- 
na e fugge via. ma torna quasi istanta- 
neamente per prenderne un'altra. Im- 
magazzina poi le noccioline nelle vici- 
nanze, ciascuna in un posto diverso, fino 
a quando il distributore è vuoto. Allora 
comincia ad andare alla ricerca del cibo 
che ha nascosto. 

Negli Stati Uniti sudoccidentali un al- 
tro uccello, la nocciolaia dì Clark, affine 
alle ghiandaie e ai corvi, mostra un analo- 
go comportamento: alla fine dell'estate 
raccoglie i pinoli dei pini, se ne riempie a 
più riprese la tasca sublinguale, una sacca 
sotto la lingua, e vola via per parecchi 
chilometri per andarli a seppellire. Spesso 
i siti dove avviene il seppellimento si tro- 
vano su pendii senza vegetazione, rivolti a 
mezzogiorno, dove più avanti ne! corso 
dell'anno la neve non raggiungerà mai un 
notevole spessore. Una nocciolaia può 
seppellire fino a 33 000 pinoli, formando 
provviste di quattro-cinque semi ciascu- 
na. Nel corso dell'inverno ritorna e inco- 
mincia a scavare le sue migliaia di na- 
scondigli. 

Come fanno questi uccelli a trovare le 
loro provviste? Le cince o le nocciolaie 
ricordano davvero dove hanno immagaz- 



zinato ogni nocciolina, ogni provvista di 
pinoli'? Fino a non molto tempo fa, ì ricer- 
catori che osservavano il comportamento 
in natura degli uccelli che fanno incetta di 
cibo dubitavano che essi potessero basarsi 
sulla memoria. Tanto per dirne una. l'uc- 
cello dovrebbe davvero avere una memo- 
ria capace per ricordare i siti dove ha posto 
centinaia o migliaia di provviste, raccolte 
individualmente. La memoria dovrebbe 
essere, inoltre, duratura. Anche un uccel- 
lo, come la cincia bigia, che impiega poco 
tempo ad andare a nascondere il proprio 
cibo, non lo recupera prima che siano tra- 
scorse ore o giorni; un uccello, poi, che 
impieghi molto tempo a immagazzinare il 
proprio cibo (per esempio la nocciolaia di 
Clark), non ritorna al suo bottino per mesi, 
forse solo al sopraggiungere della prima- 
vera, quando deve nutrire con i pinoli la 
propria prole. Inoltre, in teoria, non è ne- 
cessaria la memoria per il recupero delle 
provviste: un uccello, per esempio, po- 
trebbe immagazzinare il cibo di cui ha fatto 
incetta solo in certi tipi di nascondìgli, 
come quelli sui pendii rivolti verso sud o le 
cavita nelle cortecce dei tronchi d'albero. 
Per il recupero, basterebbe che cercasse 
solo in luoghi di questo genere. Allora po- 
trebbe impiegare la memoria solo per l'a- 
rea in cui ha immagazzinato il proprio cibo, 
più che per i singoli nascondigli; all'interno 
dell'area, poi, potrebbe andare alla ricerca 
per tentativi ed errori o - come si può 
immaginare - sollecitato da stimoli quali 
l'odore. 

Gli psicologi che studiano l'apprendi- 
mento e la memoria negli animali si stan- 
no, tuttavia, sempre più convincendo che 
certe specie mostrano specializzazioni 
adattative. che le rendono particolarmente 
capaci di apprendere e ricordare cose che 
rivestono per esse una particolare impor- 
tanza. Tra gli esempi ben noti, si ricorda la 
capacità di molti uccelli di imparare i canti 
della propria specie, la capacità di ratti e 
altri animali di ricordare localizzazioni 



spaziali, la capacità delle api di ricordare la 
posizione dei fiori e, infine, la capacità di 
molti animali di imparare a evitare gli ali- 
menti nocivi. Se poi, davvero, gli uccelli 
che immagazzinami il cibo sono in grado di 
ricordare un gran numero di nascondigli 
per lunghi periodi di tempo, tale loro 
memoria potrebbe essere un altro esempio 
di specializzazione adattativa. che rende- 
rebbe gli uccelli capaci di recuperare le 
loro provviste con notevole efficienza. Un 
uccello che potesse ricordare dove ha na- 
scosto il cibo compirebbe un minor nume- 
ro di errori per recuperarlo e spenderebbe 
meno tempo ed energia degli uccelli che, 
invece, compiono le loro ricerche in modo 
del tutto casuale. Studi recenti hanno for- 
nito risultati indicativi, secondo cui almeno 
alcune specie che immagazzinano il cibo 
ricordano i siti dove hanno nascosto il loro 
bottino. 

Negli ultimissimi anni, John R. Krebs e 
collaboratori dell'Università di Ox- 
ford hanno accumulato alcune tra le pro- 
ve più particolareggiate della capacità 
degli uccelli di ricordare i siti esatti in cui 
immagazzinano il loro cibo. Questi stu- 
diosi hanno incominciato con il cercare 
prove che confermassero che le cince bi- 
gie nel loro ambiente naturale recupera- 
no il cibo nascosto. A questo scopo, alcuni 
esemplari furono addestrati a dirigersi 
verso distributori di semi di girasole, posti 
nei territori di questi uccelli nello Wyt- 
ham Wood, vicino a Oxford. Richard J. 
Cowie, Krebs e David F. Sherry rivestiro- 
no quindi tali semi con una sostanza ra- 
dioattiva innocua. (Gli uccelli rimuovono 
il rivestimento esterno prima di mangiare 
il seme vero e proprio.) La radioattività 
permise ai tre ricercatori, attrezzati con 
un contatore a scintillazione portatile, dì 
trovare i semi che gli uccelli avevano na- 
scosto e quindi di controllarli ogni certo 
numero di ore per vedere quando scom- 
parivano. 



Naturalmente i semi potrebbero essere 
mangiati da altri uccelli o da roditori 
come i topi o i toporagni. Cowie. Krebs e 
Sherry pensarono allora che, se le cince 
bigie utilizzavano la memoria per recupe- 
rare le loro provviste, i semi sarebbero 
scomparsi più rapidamente dai siti dove 
esse li avevano immagazzinati che da altri 
«falsi sitiir-. predisposti dai ricercatori. E 
ciò, difatti, avvenne. I semi che le cince 
avevano messo da parte furono consuma- 
ti più in fretta dei semi che i ricercatori 
avevano posto in siti analoghi, ciascuno a 
un metro di distanza da una provvista fat- 
ta dagli uccelli. Nello Wytham Wood le 
provviste naturali, in inverno, venivano 
consumate in un giorno o due. L'ultima 
delle false provviste fu esaurita poco 
dopo, il che suggerisce che la predazione 
è, comunque, un fallo comune. 

L'nu tattica difensiva che le cince bigie a 
quanto pare adottano contro gli animali 
che predano le loro scorte consiste nel 
disperdere i semi invece che seppellirli a 
mucchi. In media, la distanza tra i vari 
nascondigli che le cince bigie avevano al- 
ieni ito nello Wvtham Wood era di diversi 



metri. Sherry, Mark Avery e Alien Ste- 
vens prepararono false provviste di semi 
di girasole e trovarono che quei semi du- 
ravano tanto più a lungo quanto più essi 
erano distanziati, fino a una distanza di 
circa sette metri. Le scorte più distanti 
ancora non erano invece più sicure di 
quelle distanti sette metri. Almeno nello 
Wytham Wood le cince bigie davano l'im- 
pressione di aver raggiunto, per le scorte, 
la distanza ottimale. 

Dopo aver ricavato delle prove che le 
cince bigie in natura recuperano le loro 
scorte, Krebs e collaboratori cominciaro- 
no a compiere osservazioni in laborato- 
rio. Anche in cattività le cince bigie, dota- 
te di una ciotola con dei semi e di adatti 
siti di immagazzinamento, formano le 
loro provviste rapidamente. I tre ricerca- 
tori (Krebs, Sherry e Cowie) misero a loro 
disposizione cassette contenenti muschio, 
delle dimensioni di un metro di lato e 
dove sì potessero nascondere i semi. Fu 
chiaro così che le cince si ricordavano 
benissimo dove avevano messo le provvi- 
ste, anche dopo ventiquattr'ore. In questi 
esperimenti, però, il comportamento del- 



le cince veniva registrato solo come visite 
ad aree relativamente ampie della super- 
ficie della cassetta. Inoltre, nel tentativo 
di vedere se quegli uccelli si servivano 
davvero solo della memoria nel corso de- 
gli esperimenti, i semi nascosti venivano 
rimossi dalla cassetta prima che essi vi 
ritornassero. Cosi, era difficile dire con 
quale precisione gli uccelli riuscivano a 
localizzare i siti dove avevano posto le 
loro provviste; era parimenti difficile 
identificare gli errori che essi potevano 
compiere. 

Quando una borsa di studio Guggen- 
heìm mi permise di trascorrere un anno 
sabbatico a Oxford, il mio interesse per 
le specializzazioni adattative dell'ap- 
prendimento e della memoria mi spinse 
verso lo studio delle cince bigie. Krebs e 
io progettammo alcuni esperimenti per 
analizzare in maggior dettaglio l'evidente 
memoria di questi uccelli ed eravamo 
particolarmente interessati a scoprire se 
il cibo immagazzinato più di recente era 
anche quello che essi recuperavano per 
primo. Questo «effetto del recente» 
compare spesso nei test sulla memoria e 




L'immagazzinamento di cibo da parte di una nocciolaia di Clark è 
illustralo in unii sequenza di disegni basali sulle osservazioni compiute 
da .Stephen lì. Yandrr Wall della l'tah State University. La nocciolaia 
conficca il becco nel suolo per smuoverlo (a), quindi vi inserisce un 
seme di conifera (b) e vi raccoglie sopra terriccio ed erba (e), che 
tradirne con un sasso (si). Questo serve solo a mimetizzare il sito fino a 



quando il tempo meteorologico cela ogni traccia del nascondiglio. 
L'intero procedimento richiede dai 10 ai 21) secondi. In natura, la 
nocciolaia riesce ad accumulare Tino a 33 000 pinoli in migliaia di 
nascondigli, che ne contengono da quattro a cinque ciascuno e coprono 
una vasta area. Kssa fa incetta da settembre a novembre e si basa sulla 
memoria per andare a ritrovare le scorie durante il resto dell'anno. 



58 



59 



vi sono validi motivi per prevederlo an- 
che nel caso di incetta di cibo: se le 
provviste sono destinate a finire in bocca 
ai saprofagi a una velocità costante, è 
chiaro che, in un qualsiasi momento, le 



provviste più recenti sono anche quelle 
alle quali gli uccelli che le hanno raccolte 
hanno più facile accesso. Cercarle per 
prime costituisce, dunque, per questi 
animali la miglior scelta. 



In un vasto locale, Krebs e io ponemmo 
pezzi di rami d'albero, in ognuno dei 
quali avevamo praticato fori delle di- 
mensioni giuste per inserirvi semi di ca- 
napa. Scavammo in tutto un centinaio di 





La prova che le nocciolaie di Clark fossero dotate di memoria è emersa da 
esperimenti realizzati da Vander Wall, Qui, una nocciolaia viene lasciata 
libera di nascondere dei semi (pallini neri) in un'area ovale sul fondo 
sabbioso di una voliera; a ogni estremità dell'ovale sono stale poste 
quattro pietre (disegna in allo) . L'ovale è stato allungato di 20 centimetri 
e le pietre a destra sono state spostate di conseguenza (disegno in basso). 



Due giorni dopo l'uccello ha potuto cercare le proprie scorte: a sinistra 
(cerchietti in colore) ha scavato con successi); a destra, ha compiuto degli 
errori di circa 20 centimetri, È evidente che si liasava sul ricordo delia 
posizione delle pietre vicino alle quali aveva nascosto ì semi. Gli errori 
compiuti al centro dell'ovale fanno pensare, invece, che slimasse la 
posizione di alcune provviste riferendosi ad ambedue le serie di pietre. 



60 



fori e ciascuno venne ricoperto da un 
lembo di tela, che l'uccello doveva solle- 
vare per poter deporre il seme o prele- 
varne uno, 

Ouel locale fu sede di tutta una serie di 
esperimenti. Nel nostro primo esperi- 
mento, per ogni prova abbiamo lasciato 
che una cincia bigia immagazzinasse do- 
dici semi che si era procurata da una cio- 
tola posta sul pavimento al centro del 
locale. Ogni foro poteva contenere solo 
un seme, quindi i vari semi vennero posti 
in altrettanti fori diversi. Una volta na- 
scosti i semi, tenemmo l'uccello fuori dal- 
la stanza per circa due ore e mezzo. Le- 
vammo la ciotola con i semi e quindi fa- 
cemmo entrare di nuovo l'animale che 
subito andò alla ricerca dei semi che ave- 
va nascosto. Se avesse dovuto ricercare 
casualmente tra cento fori, avrebbe do- 
vuto esaminare una media di circa otto 
fori per trovare un seme. In realtà l'effi- 
cienza delle cince si rivelò mollo più ele- 
vata. In media, ogni soggetto faceva due 
errori per seme. All'inizio di un test di 
recupero, un uccello trovava direttamen- 
te tre o quattro semi senza mai cercare in 
fori vuoti. 

Poteva darsi che, per trovare i semi, 
invece di utilizzare la memoria, le cince si 
servissero dell'olfatto o di qualche altro 
mezzo al quale non avevamo pensato. 
L'olfatto sembrava improbabile; tale sen- 
so è generalmente poco sviluppato negli 
uccelli. Ancora una volta, per saggiare 
queste possibilità, lasciammo che una cin- 
cia immagazzinasse dodici semi e quindi 
glieli spostammo in altri fori (fori che essa 
aveva utilizzato in precedenti prove). In 
queste circostanze, i soggetti remtrodotti 
nel locale fecero circa sei errori per seme 
e, alla fine, guardando in più fori del soli- 
to, riuscirono a recuperare i due terzi dei 
semi. 

Ouesti risultati indicano che le cince 
bigie non scoprivano i semi nascosti con 
l'olfatto o mediante qualche mezzo ana- 
logo. D'altra parte, la loro prestazione 
nel primo esperimento non significa ne- 
cessariamente che si ricordino dove han- 
no immagazzinato esattamente un seme 
su cento fori. In una certa misura, ogni 
uccello del laboratorio sviluppò una pre- 
ferenza per fori nei quali depositava semi 
con particolare frequenza; con ogni pro- 
babilità, quando cercava cibo, ispeziona- 
va per primi i fori preferiti. L'operazione 
di recupero dei semi da questi poteva 
essere dovuta all'abitudine dell'uccello - 
e a nulla di più - di visitare quei fori, sia 
per depositarvi semi, sia per prelevarli. 
In verità, questa tendenza probabilmente 
spiega perché, quando spostammo i semi 
nascosti, la prestazione delle cince fu 
migliore di una prestazione puramente 
dovuta al caso. 

Un più attento esame dei nostri dati 
mostrò che una cincia non andava sem- 
plicemente agli stessi fori a ogni test. 
Anche i fori che preferiva di più veniva- 
no ispezionati con maggiore probabilità, 
durante il recupero dei semi, se la cincia 
vi aveva effettivamente posto un seme. 
Il problema era, ciononostante, di fon- 
damentale importanza: nei convenziona* 




La lasca sublinguale della nocciolaia di Clark è una sacca situala sotto alla lingua nella quale 
queslu uccello trasporta i semi. Si tratta di una speciali/ za/ione anatomica che rende la nocciolaia 
perfettamente idonea a trasportare e a immagazzinare semi. Quando Vander Wall ha scattato 
questa fotografia ai raggi X, la tasca conteneva 38 semi con un peso netto di 30,6 grammi. 



li test di laboratorio sulla memoria, lo 
sperimentatore fornisce all'animale l'in- 
formazione che deve cercare di ricorda- 
re. Nelle nostre prove, invece, furono gli 
uccelli stessi a fornire l'informazione 
quando immagazzinarono i semi nei siti 
prescelti. Qualunque tendenza che po- 
tessero avere a guardare dentro gli stessi 
fori, in visite successive al locale dove si 
svolgevano le prove, li avrebbe indotti a 
comportarsi come se la loro memoria 
nei riguardi delle scorte immagazzinate 
fosse buona. 

pertanto, il nostro esperimento succes- 
l sivo fu programmato in modo da far 
lavorare la memoria degli uccelli contro la 
loro tendenza a preferire certi siti di im- 
magazzinamento. Di nuovo a ogni uccello 
vennero fatti immagazzinare dei semi, poi 
lo si fece uscire dal locale, per riammet- 
tervelo circa due ore più tardi. Nella se- 
conda sessione di prove, invece di far cer- 
care semi all'animale, lo lasciammo ac- 
cumulare altri semi. Perché lo facesse. 
lasciammo soltanto una ciotola piena di 
semi nella camera. Secondo noi, se le cin- 
ce ricordavano quali fori contenevano già 
semi, li avrebbero evitati nell'immagazzi- 
nare il secondo lotto. O, all'inverso, se 
ispezionavano gli stessi fori ogni volta che 
visitavano il locale, molti fori che ispezio- 



navano durante la seconda visita sarebbe- 
ro già stati occupati. 

I risultati furono chiarì. Quando im- 
magazzinavano un secondo lotto di semi, 
gli uccelli non ispezionavano quasi mai 
fori che già ne contenevano uno. Quando 
però avevano fame e non c'erano più 
semi da immagazzinare, mostravano la 
loro abituale efficienza nel recuperare i 
semi dai fori. Fu interessante notare che 
un uccello che deve immagazzinare un 
secondo lotto di semi spesso sceglie fori 
che si trovano vicino a quelli dei quali si 
era servito per immagazzinare il primo 
lotto. Sembra, dunque, che si ricordi ed 
eviti singoli fori e non zone della stanza o 
rami particolari. 

Dopo aver immagazzinato due lotti di 
semi, lasciammo che l'uccello li recupe- 
rasse tutti. In questo modo riuscimmo a 
saggiare l'effetto del recente di cui ab- 
biamo parlato. Se le cince lo possedesse- 
ro, dovrebbero recuperare i semi del se- 
condo lotto prima o più spesso di quelli 
del primo. 1 risultati che abbiamo ottenu- 
to suggeriscono che un effetto del genere 
esiste, ma non è molto spiccato. Se però la 
memoria dei siti di immagazzinamento si 
attenua lentamente, due episodi di incetta 
del cibo dovrebbero essere distanziati da 
più di due ore perché l'effetto del recente 
possa essere chiaro. 



61 




La specializzazione anatomica di quattro uccelli che vivono negli Sfati Uniti sudoccidentali cor- 
risponde al grado variabile di dipendenza dalle scorte di cibo. La nocciolaia di Clark (a) ha il 
maggior grado di dipendenza ed è la più specializzata: oltre a una tasca sublinguale possiede un 
lungo becco affilato con cui apre le pigne per ricavarne i pinoli. Inoltre, e un robusto volatore che 
può compiere lunghi tragitti con un carico di semi. I.a ghiandaia dal capo azzurro (b) e la cianocilta 
di Steller (e) hanno anatomia e comportamento intermedi. Trasportano semi nel loro esofago 
estensibile e non in una tasca sublinguale specializzata. L'afelocoma azzurra ttli è la meno dipen- 
dente dalle scorte di semi e possiede l'anatomia meno specializzata. Può porlare ì semi solo in 
bocca e nel becco. La capacità di trasportare semi viene indicata da una linea tratteggiata in colore. 



Un altro risultato è emerso dagli espe- 
rimenti. È ovvio che un buon ricercatore 
di cibo immagazzinato raramente do- 
vrebbe ispezionare siti vuoti. Inoltre, 
dovrebbe essere in grado di ricordare 
dove è già stato per recuperare cibo, in 



modo da evitare di ritornare sui suoi pas- 
si. Ratti di la hi) i-ut orio. messi di fronte al 
compito di raccogliere cibo da un certo 
numero di siti posti in un ampio labirin- 
to, dimostrarono di avere quest'ultima 
capacità. Così anche le cince bigie. Negli 





La cincia bigia vive in Gran Bretagna e in altri paesi europei. Immagazzina i semi se sono disponi- 
bili in quantità maggiori di quelle che le servono al momento come alimento. Il suo comportamento 
tipico la porta a ritornare sulle scorte che ha nascosto entro poche ore o al massimo pochi giorni. 



esperimenti che Krebs e io effettuammo, 
i fori che un uccello ispezionava nell'ope- 
razione di recupero dei semi erano ispe- 
zionati una seconda volta mollo meno di 
quanto si poteva prevedere se l'uccello 
non avesse ricordato ed evitato tali siti. 
Negli esperimenti svolti da Sherry, gli 
uccelli tendevano, infatti, a non ispezio- 
nare aree di muschio dove già avevano 
cercato semi, Pertanto, una cincia bigia 
in cerca di cibo immagazzinato si serve di 
due tipi di informazioni: ricorda dove si 
trovano le provviste e al tempo stesso 
memorizza i siti che ha già ispezionato. 

Se l'informazione sui siti di immagazzi- 
namento viene archiviata nel cervello 
della cincia, la memoria di quest'ultima 
dovrebbe essere soggetta a una peculiari- 
tà del sistema nervoso che sembra essere 
presente in molti uccelli. In numerosi ver- 
tebrati (tra cui l'uomo) le informazioni 
relative alla metà sinistra del campo visi- 
vo provengono da ambedue gli occhi, ma 
sono dirette alla metà destra del cervello e 
viceversa. La situazione è leggermente 
diversa in uccelli come la cincia bigia, in 
cui gli occhi sono situati ai lati del capo e 
ogni occhio ispeziona un campo visivo 
distinto. La ricostruzione delle vie per- 
corse dall'informazione nel cervello di 
questo uccello e i risultati di esperimenti 
realizzati in prevalenza con piccioni fan- 
no pensare che in questi animali l'infor- 
mazione che raggiunge il cervello attra- 
verso un occhio venga immagazzinata in 
primo luogo nella metà del cervello che 
si trova sul lato opposto del capo. In bre- 
ve, le cince bigie hanno uno scarso tra- 
sferimento interoculare per molti tipi di 
informazione o non ne hanno affatto. 
Sherry, in collaborazione con Krebs e 
Cowie, si servi di questo fatto per inter- 
pretare un interessante comportamento 
che le cince bigie mostrano quando im- 
magazzinano un seme. Dopo aver dato 
un colpetto al seme o averlo fatto pene- 
trare nel foro, l'uccello immediatamente 
piega la testa all'indietro prima da un 
iato e quindi dall'altro, come se stesse 
guardando il sito di immagazzinamento o 
i punti di riferimento vicini, prima con un 
occhio e poi con l'altro. 

La cincia compie questi movimenti 
della testa per poter archiviare l'infor- 
mazione visiva sui siti di immagazzina- 
mento in ambedue le metà del cervello? 
Per rispondere a questo interrogativo 
Sherry fece immagazzinare alle cince 
semi di girasole, dovunque volevano in 
una cassetta piena di muschio e facendo 
in modo che un loro occhio fosse coperto 
da una mascherina traslucida. Se in un 
secondo tempo, gli stessi soggetti, sem- 
pre con l'occhio coperto, dovevano ricer- 
care i semi, li ritrovavano normalmente. 
Se, invece, la mascherina veniva spostata 
sull'altro occhio, in modo che le ricerche 
dovevano essere effettuate con l'occhio 
che non aveva visto i siti di immagazzi- 
namento, la cincia si comportava come se 
non si ricordasse dove erano i semi. Se 
nelle cince non si verifica affatto trasfe- 
rimento interoculare di informazione, o 
esso è molto scarso, il loro comporta- 



62 



mento è un'ulteriore prova che esse, per 
recuperare le loro provviste, fanno affi- 
damento sulla memoria. 

Che dire dì altri uccelli che immagaz- 
zinano il cibo? Negli ultimissimi anni, 
diversi ricercatori hanno studiato uccelli 
come la nocciolaia di Clark, che costitui- 
sce, per l'inverno, migliaia di riserve. 
Anche per questa specie, sia in natura sia 
in laboratorio sono state cercate prove 



della presenza di una memoria. Natu- 
ralmente uno studio sul campo per cerca- 
re di scoprire, per esempio, se una noc- 
ciolaia di Clark recupera o no le proprie 
provviste, è molto difficile da compiere a 
causa del numero elevato di nascondigli 
e del lungo intervallo di tempo che inter- 
corre tra l'immagazzinamento e il recu- 
pero. Ben pochi sarebbero disposti ad 
aspettare parecchi mesi vicino al nascon- 



diglio di una nocciolaia, sperando di riu- 
scire a sapere prima o poi se verrà dì 
nuovo aperto dallo stesso uccello che vi 
aveva posto le sue riserve, 

"poiana Tomback dell'Università del 
*S Colorado a Denver ha sostenuto, 
però, che si potrebbero imparare molte 
cose dal modo in cui le nocciolaie di Clark 
ricercano le loro provviste, e ha sfruttato 




I a scomparsa delle scorte di cibo dallo Wylham Wuud vicinu a 0\iord è 
stata la prima conferma del fatto che le cince bigie utilizzano la memoria 
per recuperare il cibo nascosto. R. J. Omie, J. R. Krebs e D. F. Sherry 
dell'Università di Oxford hanno rivestito 20 semi di girasole con una 
sostanza radioattiva, quindi con un conlatore a scintillazione portatile 



hanno trovato dove una cincia bigia li aveva nascosti (a, pallini neri). 
A un metro di distanza da ogni nascondigli» i ricercatori ne fissarono 
uno falso (pallini in rotore) . Dieci ore dopo Ih). 1 9 falsi nascondigli erano 
rimasti indisturbati, mentre dei nascondigli dell'uccello solo Ire non venne- 
ro toccati. Vennero compiuti ulteriori controlli dopo 19 (e) e 30 ore (d). 



64 



il fatto che questi uccelli lasciano una 
documentazione delle loro ricerche sotto 
forma di segni dei loro becchi sulla neve o 
sulla terra che scavano. Si possono, inol- 
tre, identificare i successi di queste ricer- 
che nella presenza di rivestimenti di pinoli 
vicino alle buche dalle quali questi semi 
sono stati prelevati. Se le nocciolaie ricer- 
cassero t loro bottini a casaccio, i nascon- 
digli esplorati con successo e i gruppi di 
quelli esplorati a vuoto dovrebbero essere 
più o meno uniformemente distribuiti nel- 
le aree dove esse hanno svolto le loro 
ricerche. Al contrario. Diana Tomback 
ha trovato che quelli esplorati a vuoto 
erano addensati attorno agli altri. Un si- 
mile quadro suggeriva che le nocciolaie 
non dovevano aver cercato i loro bottini 
per tentativi ed errori. Inoltre, all'inizio 
della primavera (cioè prima che i roditori 
avessero scoperto molte delle provviste), 
circa i due terzi dei nascondigli erano stati 
esplorati con successo, una quantità di 
gran lunga superiore a quella che ci si 
aspetterebbe nel caso di lui a ricerca curi- 
dotta a casaccio. 

Le osservazioni di Diana Tomback non 
dimostrano in modo inequivocabile che le 
nocciolaie fossero in grado di ricordare 
dove si trovavano le loro provviste. Per 
esempio, potevano averle scoperte con 
l'olfatto (anche se, di nuovo, questa pos- 
sibilità è parsa improbabile). Ò, in alter- 
nativa, potevano averle cercate princi- 
palmente nelle località del tipo di quelle 
dove con tutta probabilità sarebbe stato 
facile trovarle. Recenti studi di laborato- 
rio, effettuati da Stephen B. Vander Wall 
presso la Utah State University sembrano 
escludere queste possibilità. Vander Wall 
ha studiato quattro nocciolaie di Clark in 
cattività in una grande uccelliera all'aper- 
to. Due di questi esemplari subito nasco- 
sero i semi nel terreno sabbioso del recin- 
to; gli altri due no. Malgrado questo, an- 
che gli uccelli che non avevano accumula- 
to riserve scavarono nella sabbia con il 
becco e mangiarono i semi sepolti che 
erano riusciti a scoprire. Vander Wall 
fece in modo che i due uccelli che costitui- 
vano scorte potessero seppellire i loro 
semi nel recinto; quindi lasciò liberi tutti e 
quattro gli esemplari di cercare i semi 
nascosti, 

I risultati fornirono una prova sensa- 
zionale dell'esistenza di una memoria in 
questi animali. Quando le nocciolaie che 
avevano fatto incetta di semi scavarono 
nella sabbia per trovarli, il 70 per cento 
dei loro tentativi andò a buon frutto; 
quando, invece, si misero all'opera gli 
uccelli che non avevano allestito scorte 
solo il 1 per cento dei loro tentativi ebbe 
successo. Senza dubbio, un successo del 
IO per cento è sostanzialmente superiore 
a quello che ci si potrebbe aspettare da un 
uccello che compie i suoi tentativi com- 
pletamente a caso. D'altra parte, le due 
nocciolaie che nascondevano i semi pre- 
ferivano farlo vicino a oggetti sporgenti, 
tronchi oppure pietre poste nella voliera; 
tutti e quattro gli uccelli il più delle volte 
cercavano proprio attorno a questi ogget- 
ti. Una simile tendenza spiega il successo 
ottenuto nella ricerca anche dagli uccelli 



che non avevano fatto provvista di semi. 

Forse la presenza di oggetti sporgenti 
vicini serve da stimolo per la memoria 
quando gli uccelli tentano di trovare le 
loro scorte. Per comprovare questa ipo- 
tesi, Vander Wall copri con un foglio di 
plastica il fondo delia voliera, lasciando 
scoperta solo un'area ovale in cui la pla- 
stica era stata tagliata. A ogni estremità 
di quest'area pose quattro oggetti, di 
grandi dimensioni, come quattro pezzi di 
roccia. Le nocciolaie furono lasciate libe- 
re di allestire le loro scorte dove voleva- 
no nell'ovale. A questo punto, una delle 
estremità dell'ovale venne estesa di 20 
centimetri e anche i quattro oggetti ivi 
localizzati furono spostati in direzione 
dell'allungamento per cui vennero an- 
ch'essi a trovarsi a 20 centimetri dalla 
posizione originale. 

Le nocciolaie erano ancora in grado di 
trovare le loro provviste in corrisponden- 
za dell'estremità modificata cosi come 
trovavano quelle all'altra estremità non 
modificata, oppure i loro tentativi anda- 
vano a vuoto per 20 centimetri? Si verifi- 
cò proprio questo secondo caso. L'entità 
del successo in corrispondenza dell'e- 
stremità non modificata dell'ovale fu ele- 
vata e si abbassò, invece, verso l'estremità 
modificata. La maggior parte dei sondag- 
gi in corrispondenza dell'estremità modi- 
ficata avvenne entro pochi centimetri dal 
punto ritenuto «giusto» rispetto alla posi- 
zione alterata del grosso oggetto più vici- 
no. Gli uccelli compivano errori anche 
vicino al centro dell'ovale, ma erano erro- 
ri meno marcati. Questo risultato fa pen- 
sare che i siti per le provviste erano stati 
prescelti con riferimento ad ambedue le 
serie di oggetti. 

Per qualunque specie che disperda le 
proprie provviste e si basi sulla me- 
moria per il loro recupero, ci si può chie- 
dere se la memoria venga sfruttata anche 
in altro senso. In altre parole, le specie 
che immagazzinano il cibo sono in genera- 
le avvantaggiate nel ricordare dove sono 
le cose, rispetto alle altre specie? II tenta- 
tivo di rispondere a un interrogativo del 
genere richiederebbe di sottoporre gli 
animali a test di memoria spaziale che non 
comportino l'immagazzinamento di cibo. 
Test del genere non sono stati ancora ef- 
fettuati con uccelli che immagazzinano il 
cibo, ma il solo riflettere sul modo in cui 
potrebbero essere impostati mette in luce 
alcuni punti importanti. 

Tra le tecniche di laboratorio utilizzate 
dagli psicologi per studiare la memoria 
degli animali, l'analogo più vicino all'ope- 
razione di far incetta di cibo è un esperi- 
mento a risposta ritardata, in cui viene 
presentato a un animale qualche stimolo 
visivo, per esempio una luce lampeggian- 
te o una figura geometrica. Quindi viene 
offerta una scelta tra questo stimolo ori- 
ginario e un altro stimolo e si ricompensa 
l'animale per aver scelto quello che ha 
notato per primo. Se passano alcuni se- 
condi o addirittura alcuni minuti tra la 
prima visione e la seconda, la prestazio- 
ne di un ratto di laboratorio oppure di 
un piccione scende tipicamente al livello 



ARTE 



IjR M JR.NXr,r edizione italiana di 

SCIKVriFIC UWERICAN 

ha dedicato all'argomento 
diversi articoli: 



L'olografia nel campo del restauro 

di F. Gori e G. Urbani (n. 74) 



L'origine dell'ambiguità 

nelle opere di Maurits C. Escher 

di M. L. Teuber (n. 75) 



Pieter Bruegel il Vecchio 

e la tecnica del Cinquecento 

diH. A. Klein (n. 117) 



La conservazione della pietra 
di K. L. Gauri (n. 120) 



I disegni preistorici 
tracciati sul terreno in Perù 

di W. H. Isbell (n. 124) 



L'< infrarosso colore» 
nell'Indagine dei dipinti 

di M. Matteini, A. Moles e P. Tiano 
(n. 142) 



La statica dall'arte alla scienza 

di S. Clara Re-ero (n. 150) 



Norme architettoniche 
nella Cina del XII secolo 

di E. Glahn (n. 155) 



L'architettura di Christopher Wren 
di H. Dom e R. Marck (n. 157) 



L'acustica del piani armonici 
di violino 

di C. Malcy Hutchìns (n. 160) 



Conservazione e restauro 

di P. Parrini (n. 161) 



Intarsi rinascimentali: 

l'arte della geometria 

di A.Tormey e Y. FarrTormey (n. 169) 



65 



di un comportamento del lutlo casuale. 
Di recente. Donald M. Wilkie e Russel 
Summers dell'Università della Columbia 
britannica hanno addestrato dei piccioni 
basandosi su un procedimento che è una 



variante di quello della risposta ritardata 
e richiede memoria spaziale. Tale lavoro 
illustra alcune differenze che esistono tra 
studi di laboratorio convenzionali sulla 
memoria animale e studi sugli uccelli che 



fanno incetta di cibo. Nell'esperimento di 
Wilkie e Summers. un piccione veniva 
messo di fronte a una serie di nove dischi 
bianchi disposti a formare una matrice di 
tre per tre. che potevano anche essere 




L'autore e Krebs hanno compia Iti 4 esperimenti per provare la memoria 
delle cince bigie. In ogni caso, uno (ti questi uccelli ha immagazzinato 
semi in alcuni dei circa ll)f) Tori che gli sperimentatori avevano praticato 



nei rami d'albero positi nel locale del laboratorio. Qui, una cincia bigia ha 
nascosto dodici semi r pallini inerì e in colore) : due ore e mezzo dopo, ita 
trovato dieci dei dodici semi (pallini in colore) ispezionando solo 24 fori. 




In un secondo esperimento, una cincia bigia ha immagazzinato 13 semi 
(cerchielli neri), che dopo sono slati spostati altrove (pallini neri e 
in colore) da Krebs e dall'autore. Tra i primi 24 fori che la cincia ha 



ispezionato una volta tornala nel locale, 11 erano furi che aveva utiliz- 
zato. L'esperimento indica che essa non scopriva i semi spinta da uno 
stimolo olfattivo. Riusci a trovare quattro semi (pallini in colore). 



66 



illuminati individualmente da dietro. Al- 
l'inizio di ogni prova, un disco veniva il- 
luminato per breve tempo. Pochi secondi 
dopo veniva illuminato di nuovo, insieme 
con un altro disco o con diversi altri. Il 



piccione veniva ricompensato (riceveva 
un poco di cibo) se beccava il disco che era 
stato illuminato due volte. 

Il compito del piccione sembra simile a 
quello che deve affrontare un uccello che 



immagazzini cibo. Dopo tutto, tjuest'ul- 
timo è esposto a stimoli visivi ebe pri 
gono dal luogo dell'immagazzinamento e, 
per poter recuperare il cibo, deve selezio- 
nare il silo preferendolo ad analoghi siti 




Nel terzo esperimento, una cincia bigia immagazzinò due lotti di semi. 
Nello scegliere i fori per il secondo lotto (cerchi neri con il punto), ha 
evitato quei fori nei quali aveva immagazzinato il primo lotto (cerchi 



neri senza punto). Questo risultato permette di stabilire che la cincia, 
sta che immagazzini i semi sia che li vada a recuperare, non mila mai 
casualmente una particolare serie di furi: essa ricorda don- è già stata. 




[.'ultimo esperimento riguardava il recupero di ambedue ì lotti di otto 
semi da parte della cincia bigia che ti aveva immagazzinati. Ispezio- 
nando 29 fori, essa ha trovato 10 semi: quattro (cerchi in colore) dal 



primo lotto e sei (cerchi in colore con il punto) dal secondo. Tulle le 
prime sette ispezioni dei fori che la cincia ha compililo hanno avolo suc- 
cesso. In due casi, l'uccello ha compiuto l'errore di rivisitare un foro. 



67 




















RECUPERO PERFETTO 












• 


• 


* 


• 


• « 


|e 


- 






















* 


m 












i- 






















• 
















w 




















• 


















> 


















• 




































a 






















z 
















• * 






















tu 
















* 






















£ 
















• 






















E 4 


- 














• 






















o 














• 
























u. 


















































• 


























5 






































O 










* 




























te 






































LU 






































2 








• 






























|a 


_ 








































• 






























RICERCA CASUALE 






• 


































n 


X * 






-7- 








1 1 








» 








1 




— l 



12 16 

NUMERO DI FORI VISITATI 



20 



24 



28 



La prestazione della lincia bigia e siala riportata in grafito da krcbs e 
dall'autore di questo articoli). Se la nuda cercasse a caso otiti semi in 
cento fori, ispezionerebbe perlomeno 1 2 fori per trovare un seme. Se, 



invece, la sua memoria fosse perfetta, ispezionerebbe un solo foro per 

ir»' ari' ugni seme. I :i presta/ione della cincia bìgia t tfBtt inu-niieelia: in 
1 2 prove ha ispezionato una media di circa 3,7 fori per trovare un seme. 



vicini. Con un solo stimolo da ricordare 
per volta, i piccioni dell'esperimento di 
Wilkie e Summers non sembravano rico- 
noscere quale disco fosse stato illuminato 
solo pochi secondi dopo che l'avevano 
visto. Per contro, una nocciolaia di Clark 
ricorda chiaramente per mesi migliaia di 
siti di immagazzinamento. 

II compito del piccione differiva co- 
munque per vari aspetti da quello della 
nocciolaia: infatti, il piccione vedeva pas- 
sivamente lo stimolo che avrebbe dovuto 
ricordare. Gli stessi stimoli erano invaria- 
bilmente a pochi centimetri l'uno dall'al- 
tro e differivano solo per la posizione al- 
l'interno della matrice. Il cibo con il quale 
il piccione veniva ricompensato non era 
dietro lo stimolo. Uno qualsiasi di questi 
fattori presumibilmente rendeva il compi- 
to del piccione più arduo di quello di fron- 
te al quale si trova un uccello che faccia 
incetta di cibo. Per esempio, indagini di 
laboratorio effettuate principalmente su 
ratti mostrano che gli animali possono 
ricordare per parecchie ore i luoghi che 
visitano effettivamente. 

Può darsi, dunque, che i tipi di stimoli 
presenti in corrispondenza dei siti 
dove si accumulano le provviste siano 
proprio la causa che permette di ricorda- 
re quei siti. Secondo questa ipotesi, un 
uccello che fa incetta di cibo non do- 
vrebbe necessariamente avere una me- 
moria molto superiore a quella di altri 
animali. L'adozione di un sistema di vita 
basalo sull'incetta di cibo lo avrebbe 
semplicemente messo nelle condizioni in 
cui la sua memoria gli diventa partico- 
larmente utile. In che modo lo si potreb- 
be provare? I confronti, per quanto con- 
cerne la memoria, tra specie che imma- 
gazzinano il cibo e specie che non lo fan- 
no sono spesso compromessi da differen- 
ze nelle motivazioni e nelle possibilità 



motorie e sensoriali della specie. Ovvia- 
mente, i confronti sarebbero più signifi- 
cativi se le specie fossero affini. 

Da questo punto di vista, è degno di 
nota il fatto che. tra t corvidi (cioè le 
ghiandaie, i corvi e le nocciolaie) e tra le 
cince alcune specie immagazzinino il cibo 
mentre altre no. Tra le cince, per esem- 
pio, la cincia col ciuffo e la cincia bigia 
alpestre chiaramente immagazzinano 
cibo in autunno per nutrirsene poi in in- 
verno, proprio come fa la nocciolaia di 
Clark. La cincia bigia immagazzina cibo 
in sovrabbondanza per periodi di tempo 
relativamente brevi. La cinciarella e la 
cinciallegra non immagazzinano nulla. 

Tra i corvidi, un esempio di varie spe- 
cie correlate tra loro ma con una diversa 
tendenza ad accaparrare cibo è stato de- 
scritto da Vander Wall, in collaborazione 
con Russell P, Balda della Northern Ari- 
zona University. La nocciolaia di Clark 
vive nelle stesse aree degli Stati Uniti 
occidentali dove vivono tre altri membri 
della famiglia corvidi. e cioè la ghiandaia 
dal capo azzurro, la cianocitta di Steller e 
l'afelocoma azzurra. Le quattro specie 
differiscono in misura notevole per la 
loro dipendenza dai pinoli immagazzinati 
e, nel contempo, si diversificano per il 
modo in cui sono in grado di immagazzi- 
nare e di trasportare questi semi. 

Di tutte, la nocciolaia di Clark è quella 
che mostra un maggior grado di dipen- 
denza. Sfruttando le sue provviste dt 
semi, essa è in grado, infatti, di comincia- 
re a riprodursi fin dal mese di febbraio, 
molto prima della maggior parte degli 
altri uccelli presenti nella stessa area. 
Inoltre è anche la più specializzata ana- 
tomicamente per raccogliere e fare incet- 
ta di semi: oltre a una tasca sublinguale, 
nella quale pone una grande quantità di 
semi, possiede un lungo becco affilato 
con cui riesce ad aprire le pigne ancora 



verdi prima che possano aprirsi da sole. 
La nocciolaia di Clark è anche un poten- 
te volatore e può trasportare carichi pe- 
santi per grandi distanze fino a siti di 
immagazzinamento adatti. 

Per contro, l'afelocoma azzurra è la 
meno specializzata delle quattro specie: 
non ha gli adattamenti anatomici della 
nocciolaia di Clark e dipende molto 
meno dalle scorte di semi. Nasconde tut- 
ti i semi che mette da parte nell'area 
dove vive: area che difende come fosse 
il proprio territorio. La ghiandaia dal 
capo azzurro e la cianocitta di Steller 
hanno caratteristiche intermedie sia 
come anatomia sia come comportamen- 
to. La memoria spaziale dei componenti 
di queste tre specie è forse meno svilup- 
pata di quella della nocciolaia di Clark? 
La risposta richiede ulteriori ricerche sia 
in natura sia in laboratorio. 

Te ricerche sulla memoria e sull'incetta 
-^ dì cibo che ho descritto sono al limite 
tra gli studi zoologici e quelli psicologici di 
comportamento animale. Ricerche di 
questo stampo si stanno sempre più svi- 
luppando a mano a mano che gli psicologi 
si convincono che vale la pena di conside- 
rare gli studi di laboratorio sull'appren- 
dimento e sulla memoria come mezzi per 
analizzare in che modo gli animali risol- 
vono i problemi con i quali si trovano a 
confronto in natura. Nel contempo, gli 
zoologi si interessano sempre più agli 
aspetti dell'approvvigionamento del cibo. 
che richiedono chiaramente una capacità 
di apprendimento e di memoria. Sforzi 
congiunti possono dunque associare l'in- 
terpretazione zoologica del modo in coi il 
comportamento si adatta all'ambiente 
con gli strumenti concettuali dello psico- 
logo e le tecniche sperimentali. Essi sono 
l'inizio di nuovi e stimolanti sviluppi nello 
studio della memoria. 



68 



Il futuro dell'universo 

Una previsione per l'espansione dell'universo fino all'anno IO 100 : 
i protoni decadranno, le galassie formeranno buchi neri e i buchi 
neri «evaporeranno». Se V universo collassa, può essere ciclico 

di Duane A. Dicus. John R. Letaw, Doris C. Teplitz e Vigdor L, Teplitz 



Negli ultimi anni gli sviluppi della 
fìsica delle interazioni ad alta 
energia delle particelle elemen- 
tari hanno stimolato una notevole crescita 
della cosmologia. Il tentativo di descrive- 
re tutte le forze fondamentali della natura 
come aspetti differenti di una sola forza 
fondamentale ha avuto un parziale suc- 
cesso nelle «teorie di grande unificazio- 
ne» delle particelle elementari. Mediante 
tali teorie si possono presentare descri- 
zioni probabili dei processi fisici domi- 
nanti, dalle bassissime temperature a 
temperature dell'ordine di IO* 2 kelvin. Si 
possono perciò individuare le proprietà 
della materia a densità di interesse cosmo- 
logico, che variano da meno di 10 3,MI 
grammi a più di IO" 1 " grammi per centi- 
metro cubo. Le condizioni estreme ai con- 
fini di queste scale possono prevalere sol- 
tanto nei primissimi o negli ultimissimi 
stadi dell'evoluzione dell'universo. 

Alcuni anni fa i cosmologi cominciaro- 
no a mostrare come la fisica teorica possa 
tornire una valida spiegazione della storia 
dell'universo entro i primi IO' 3 - secondi 
dall'inizio. Più recentemente parecchi Ti- 
sici e cosmologi, tra i quali noi quattro, 
hanno estrapolato gli eventi cosmici in un 
futuro che si estende fino a 10" MI volte 
l'età stimata dell'universo. A parte il fa- 
scino intrinseco di tale impresa, vi sono 
molti motivi per affrontarla. Dal punto di 
vista della fisica teorica l'estrapolazione 
rende possibile un tipo di esperimento 
ideale: determinando in che modo t diver- 
si effetti previsti da una teoria interagi- 
scono in un dato istante, si può verificare 
la coerenza globale e la plausibilità di tale 
teoria. In nessun laboratorio ordinario è 
probabile che si possano mai raggiungere 
le temperature e le densità alle quali for- 
niscono previsioni le teorie di grande uni- 
ficatone e quindi queste teorie vengono 
sottoposte a verifica in quello che alcuni 
fisici chiamano l'ultimo laboratorio, cioè 
l'universo nel suo insieme. Dal punto di 
vista della cosmologia l'importanza delle 
nostre estrapolazioni sta nel fatto che le 
teorie di grande unificazione hanno anche 
conseguenze che si possono verificare nei 
grandi laboratori terrestri e si possono 



perciò confermare le loro previsioni sulle 
condizioni estreme. Si può pertanto trac- 
ciare una sequenza di eventi che potreb- 
bero verificarsi nel lontano futuro con 
dettagli decisamente superiori a quelli 
precedentemente possibili. 

Il punto di partenza dei nostri calcoli sul 
futuro remoto è il modello del big 
bang. Oggi si accetta generalmente che 
l'evoluzione dell'universo sia stata deter- 
minata nei primissimi istanti del big bang. 
Secondo tale modello, l'universo ebbe ini- 
zio con l'esplosione di un'entità primordia- 
le estremamente compatta, fra i 1 e i 20 
miliardi di anni fa. Il termine «big bang» e 
la terminologia relativa, che è quella usata 
per parlare di un'esplosione, sono abba- 
stanza adatti, perché pare proprio che la 
materia e l'energia siano state espulse nel- 
lo spazio da una comune origine. Il termi- 
ne potrebbe tuttavia anche ingannare, per- 
ché non è corretto supporre che l'espan- 
sione possa essere osservata dall'esterno. 
Non c'è. infatti, possibilità di osservazione 
dall'esterno, perché ciò che sta esplodendo 
è l'intero universo. Lo stesso spazio sta 
espandendo nel senso che la distanza tra 
due galassie qualsiasi sta crescendo a una 
velocità che dipende dalla loro distanza. 
Viste dalla nostra galassia, tutte le altre 
galassie appaiono allontanarsi a una velo- 
cità che aumenta di 1 7 chilometri al secon- 
do per ogni milione di anni luce di distanza. 
Matematicamente il big bang è descritto 
dalla teoria delia relatività generale di 
Albert Einstein. 

La recessione di galassie lontane viene 
dedotta dall'osservazione dello sposta- 
mento della loro radiazione verso l'e- 
stremità rossa dello spettro elettromagne- 
tico. L'espansione e il raffreddamento 
dell'universo hanno alterato ancor più 
drammaticamente lo spettro di un altro 
tipo di radiazione, cioè la radiazione co- 
smica di fondo a microonde, scoperta nel 
1964 da Arno A. Penzias e Robert W. 
Wilson dei Bell Laboratories. Questa 
radiazione di fondo sembra provenire 
con la stessa intensità da tutti i punti del 
cielo: l'intensità varia con la direzione 
per meno dì una parte su IO 000. Sono 



stale la diffusione e l'annichilazione di 
particelle elettricamente cariche nei pri- 
mi stadi del big bang a dare origine a 
essa. Un tempo, quindi, essa era molto 
calda, ma da allora si è andata raffred- 
dando, a causa dell'espansione dell'uni- 
verso, fino a raggiungere una temperatu- 
ra dì circa tre kelvin. 

Le reazioni nucleari, alla densità e alla 
temperatura dell'universo, circa tre minu- 
ti dopo l'inizio del big bang furono re- 
sponsabili della sintesi dell'elio e, in misu- 
ra molto inferiore, di altri elementi legge- 
ri. L'universo si raffreddò però troppo 
rapidamente perché potessero formarsi 
carbonio e altri elementi più pesanti e 
rimase un'abbondante riserva di idrogeno 
con la funzione di combustibile nucleare 
per le stelle. Prima ancora, reazioni avve- 
nute soltanto 1 0' M secondi dopo la nasci- 
ta dell 'universo potrebbero aver generato 
l'osservato eccesso della materia sull'an- 
timateria, nel qual caso la maggior parte 
delle teorie di grande unificazione preve- 
dono il decadimento finale di tutta la 
materia nucleare. Le attuali conoscenze 
sulle condizioni del primo universo non 
hanno tuttavia consentito di rispondere 
alla domanda più incalzante della cosmo- 
logia: l'universo continuerà a espandersi 
per sempre oppure le forze gravitazionali 
arresteranno la sua espansione e riporte- 
ranno tutto lo spazio e il tempo entro i 
limiti della sfera di fuoco dalla quale è 
cominciato l'universo? 

All'ultima domanda sono stati dedicati 
■**■ molti anni di sforzi osservazionali e 
di considerazioni teoriche, ma la questio- 
ne è ancora irrisolta. In linea di principio, 
il modo più semplice per risolverla è di 
misurare la quantità di materia in un gran- 
de e significativo volume di spazio e di 
stimare in tal modo la densità della materia 
su grande scala nell'universo. Se la densità 
è uguale o superiore a una certa densità 
critica, che è di circa tre protoni per ogni 
1000 litri di spazio, la gravità finirà col 
vincere l'espansione e l'universo collasse- 
rà. Un universo di questo tipo si dice chiu- 
so. Se la densità è inferiore al valore criti- 
co, l'universo rimarrà aperto; l'espansione 



70 



sarà rallentata dalla gravità, ma mai arre- 
stata. Si noti che processi fisici quali la 
combustione delle stelle o il decadimento 
di particelle non possono trasformare un 
universo chiuso in uno aperto. 

Stime sul numero di stelle in una galas- 
sia tipica e sul numero di galassie per uni- 
tà di volume forniscono un valore della 
densità della materia che è solo il 5 per 
cento di quello critico. Su tate base si po- 
trebbe concludere che l'universo è aperto 
e che continuerà la sua espansione per 
sempre. Tuttavia, una stima della massa 
basata sul conteggio delle stelle com- 



prende soltanto la materia luminosa; se la 
materia non luminosa costituisce una fra- 
zione significativa della massa dell'uni- 
verso, la slima non è precisa. 

Esiste qualche prova dell'esistenza di 
materia non luminosa nelle galassie. La 
velocità con cui una stella ruota attorno al 
centro della sua galassia dovrebbe au- 
mentare con la distanza da tale centro per 
le stelle che si trovano all'interno della 
galassia e dovrebbe diminuire con la di- 
stanza se la stella sì trova alla periferia. 
Per le stelle esteme, però, la prevista di- 
minuzione della velocità angolare non 



viene osservata; la distribuzione di veloci- 
tà osservata porta alla conclusione che 
alla periferia di una galass tu alo- 

ne di materia non luminosa la cui massa 
totale è una o due volte quella della mate- 
ria galattica luminosa. Quindi la materia 
non luminosa all'interno delle galassie 
può fornire un 5-10 per cento della massa 
necessaria per chiudere l'unive 

Allo stesso modo, i moti delle galassie 
osservati negli ammassi galattici paiono 
richiedere materia non luminosa suffi- 
ciente a formare il 50 per cento della den- 
sità critica dell'universo l a materia non 






• • 



t - 



* 



» • 



L'oggetto più lontano conosciuto è un quasar chiamalo PKS 2000-330; 
esso ha uno sposlamenlo verso il rosso di 3,78, cine si sta allontanando 
da noi a una velocità pari al 92 per cento della velocità della luce. 
L'enorme velocità di recessione è probabilmente un effetto dei big 
bang; se è cosi, PKS 2000-330 disia più di 16 miliardi di anni luce dalla 



nostra galassia. La fotografia e una stampa in negativo; il quasar è l'og- 
getto scuro simile a una stella, al centro. Tali oggetti distanti consento- 
no ai cosmologi di dedurre alcune condizioni dominanti in passato e di 
estrapolare certi processi nel fui uro remoto. Iji ture clic rugginir 
la Terra dal quasar deve essere stai» emessa subito dopo il big bang. 



71 



luminosa spiegherebbe perché le galassie 
restano legate in ammassi anziché muo- 
versi in direzioni casuali. La materia oscu- 
ra potrebbe essere sotto forma di rocce 
fredde, di stelle combuste, di nubi di gas o 
persino di buchi neri. 

Se la materia ulteriore necessaria per 
formare il restante 50 per cento della den- 



sità critica esiste realmente, potrebbe 
consistere di atomi di idrogeno ionizzati o 
di neutrini. L'idrogeno ionizzato dovreb- 
be essere rilevabile con i telescopi a raggi 
X in orbita attorno alla Terra. Per quanto 
riguarda i neutrini, essi dovrebbero essere 
numerosi quanto i fotoni associati alla 
radiazione cosmica di fondo; complessi- 



vamente, poche centinaia di neutrini per 
centimetro cubo. Il loro contributo alla 
densità dell'universo dipende dalla massa 
del neutrino. Un tempo si riteneva che il 
neutrino fosse privo di massa, ma gli espe- 
rimenti attuali fissano soltanto limiti su- 
periori alle masse del neutrino e non e- 
scludono la possibilità che tali masse sia- 



no sufficienti a chiudere l'universo. Inol- 
tre, argomentazioni teoriche recenti sug- 
geriscono che il neutrino abbia una qual- 
che massa e alcuni gruppi di ricercatori 
stanno cercando di rivelarla e di misurar- 
la. Nei prossimi anni tali esperimenti po- 
trebbero rispondere in modo definitivo e 
affermativo alla domanda se l'universo è 



chiuso. Del resto, un risultato negativo 
lascerebbe da risolvere il problema con 
misure più accurate delle distanze e delle 
velocità di recessione di galassie lontane. 

Anche se l'incertezza attuale sulla densi - 
■** tà dell'universo si trova a metà stra- 
da tra il valore che caratterizza un univer- 



so chiuso e quello di un universo aperto, 
l'incertezza è limitata a meno di due ordi- 
ni di grandezza. Il fatto che l'universo non 
si sia contratto prima di raggiungere la sua 
età attuale implica che il suo valore di 
densità non supera di più di 1 volte circa 
la densità critica. La stima della densità 
basata sulla materia luminosa indica da 



10'w 










O 

3 

o 
o 

X 
5 



w 

B 



S 



tu 

5 






1 sei eventi più importanti del futuro dell'universo sono previsti dalla 
teoria (bica, purché l'espansione dell'universo iniziala con il big bang 
contìnui abbastanza a lungo perché essi si verifichino. Qui la lunghezza 
di scala (che è circa equivalente al raggio dell'universo) e la densità 
sono rappresentate graficamente in funzione del tempo per quattro 
modelli dell'unitelo: uno nel quale l'universo è aperto, due nel quale 
esso è chiuso e uno sul confine definito matematicamente tra il modello 



chiuso e quello completamente aperto. Se l'universo è aperto, la densità 
della materia e dell'energia e troppo bassa perche la gravità possa 
vincere l'espansione e quindi l'universo si espanderà per sempre. Se 
l'universo è chiuso, la gravità finirà co 11 'arre sta re l'espansione e ripor- 
terà indietro l'universo in un punto di densità infinita. Non si sa se 
viviamo in un universo aperto o chiuso. Gli eventi futuri sono schema- 
tizzati: le stelle esauriscono il loro combustibile e si contraggono sotto 



l'azione del loro stesso peso in 10 14 anni; perdono i loro pianeti in 
incontri ravvicinati con le altre stelle in HI anni. Le galassie perdono 
una grande Trazione della loro massa in circa IO 18 anni, a causa di 
incontri ancor più ravvicinati tra le stelle e a causa della diffusione sia di 
atomi di idrogeno sia di particelle di polvere; aggregati di materia che 
acquistano una grande velocità attraverso gli incontri possono vincere 
le forze gravitazionali all'interno della galassia e la materia restante col- 



lassa in un buco nero supermassivo. (Un buco nero è una regione dello 
spazio dalla quale nulla sfugge se non con i meccanismi descritti dalla 
teoria dei quanti.) I protoni che decadono generano calore nelle stelle 
fredde sfuggite dalle galassie. Il riscaldamento diventa significativo dopo 
IO anni, ed entro l'anno IO' circa il 40 per cento della materia 
dell'universo ha subito tale decadimento. Dopo IO 1 ™ anni i buchi neri 
supermassivi perdono la foro massa per «evapora/ione» quantistica. 



72 



73 



sola che la densità effettiva deve essere 
almeno un ventesimo di quella critica. 
Nessuno sa ancora come spiegare quella 
che i cosmologi trovano essere una sor- 
prendente coincidenza. 

Dal momento che il problema della 
chiusura non e stato ancora risolto su basi 
sperimentali o osservazionali, entrambe 
le possibilità (universo aperto o chiuso) 
devono essere tenute presenti in qualsiasi 
speculazione sul futuro lontano. Per co- 
minciare, supponiamo che non venga 
raggiunta la densità critica e che l'univer- 
a aperto. Che cosa è probabile che 
accada? A tale domanda si deve rispon- 
dere sia per una struttura su grande scala 



(cioè per l'evoluzione delle proprietà 
geometriche dell'universo) sia per la 
composizione locale (per aggregati di 
materia le cui dimensioni vanno dai pro- 
ioni alle galassie). 

Secondo le nostre informazioni miglio- 
ri, la composizione locale dell'universo 
aperto dovrebbe suscitare sei importanti 
transizioni. La prima è che entro IO 14 
anni dal^ big bang tutte le stelle avranno 
esaurito il combustibile. 11 principale 
combustibile nucleare è l'idrogeno, che 
viene trasformato in elio nel nucleo di una 
stella per la maggior parte della sua esi- 
stenza. Una volta consumata la maggior 
parte del combustibile idrogeno, la stella 



» • • • * 

a a a « • 

■ » « * * 

i • • • a 

• a ■ ■ ■ 

• a a « a 
» » e * * 

• a • a m 
a a a « • 
a a a a a 

• ■ • • * 
a * * a a 
a a * a a 
a * a m i 
a a a a • 

• ■ a • • 
a a a a a 

• • • a * 
a * a a a 
a a a a a 



La distribuzione- della materia e dell'energia nell'universa appare sia omogenea sia isotropa EOO 
un elevato grado di precisione. In un universo omogeneo numeri uguali di galassie riempiono 
volumi paragonabili di spazio. In un universo isotropo la densità della materia e dell'energia, oltre 
a essere omogenea, è la slessa in tutte le direzioni. Le due proprietà non sono equivalenti: un 
universo omogeneo non e necessariamente anche isotropo. Se la materia è distribuita come nel 
diagramma schematico a sinistra, l'universo è sia omogeneo sia isotropo; la distribuzione mostrata 
a destra invece è omogenea ma non isotropa: la distanza tra le galassie lungo la direzione verticale 
è minore di quella lungo la direzione orizzontate. L'anisotropia in un universo omogeneo in 
espansione è prodotta da una velocità di espansione che risulta variabile con la direzione. 








La materia non luminosa può costituire una parte significativa delta massa totale dell'universo. Ci 
•.000 prove che tale materia costituisce almeno la metà della massa della maggior parte delle 
galassie. Se le galassie fossero fatte interamente di materia osservabile per via diretta, le stelle alla 
periferia di una galavsìa ruoterebbero attorno al centro galattico con una velocita che diminuisce 
eon la distanza dal centro fa sinistra). Invece la velocità osservata per te stelle periferiche non 
diminuisce con la distanza. Questa discrepanza si può spiegare supponendo che vi sia materia non 
luminosa distribuita nella galassia e in un alone attorno a essa. Perciò, le stelle che appaiono alla 
periferìa si troverebbero in realtà in mezzo alla materia galattica e la distribuzione delle loro 
velociti» con la disianza dal centro galattico riprodurrebbe più da vicino la distribuzione osservata 
(a destra). Le lunghezze delle frecce negli schemi sono proporzionali alle velocità delle stelle. 



si dilata di molte volte le sue dimensioni 
iniziali e diventa una gigante rossa: in 
questa fase della sua esistenza l'elio vie- 
ne solitamente trasformato in carbonio e 
in elementi più pesanti. Queste reazioni 
termonucleari sono efficaci transizioni a 
senso unico: l'idrogeno viene trasforma- 
to in elio, l'elio in carbonio e il carbonio 
in elementi più pesanti in una serie che 
generalmente termina col ferro. Il nucleo 
del ferro ha un'energia totale per unità di 
massa inferiore a quella di qualsiasi altro 
nucleo, in modo tale che, una volta rag- 
giunto il «limite del ferro», l'energìa del- 
l'universo immagazzinata come combu- 
stibile nucleare sarà stata interamente 
liberata. 

La velocità alla quale viene consumato 
il combustibile nucleare di una stella di- 
pende dalla massa della stella: più tale 
massa è grande, più rapidamente brucia e 
minore è di conseguenza la sua vita. Per 
esempio, il Sole consumerà la maggior 
parte del suo idrogeno entro 10 miliardi 
di anni circa, successivamente fluttuerà 
rapidamente di dimensioni, brucerà alcu- 
ni degli elementi più pesanti con una ra- 
pidità prodigiosa, ma per un tempo relati- 
vamente breve, e infine collasserà in una 
piccola nana bianca che si raffredda len- 
tamente. Le stelle più piccole attraversa- 
no tutti questi stadi in un arco di tempo 
molte volte più lungo della vita del Sole, 
ma alla fine raggiungeranno anch'esse il 
limite del ferro. Si noti che, se l'esauri- 
mento del combustibile nucleare è il pri- 
mo evento di rilievo nel futuro dell'uni- 
verso aperto, esso si verificherà in un'e- 
poca lontanissima dalla nostra. Le ultime 
stelle cesseranno di brillare solo quando 
l'universo avrà un'età 10 000 volte supe- 
riore a quella attuale. 

Il secondo evento importante è che tutte 
le stelle perderanno i loro pianeti. Se 
una stella con un pianeta viene avvicinata 
da un'altra stella entro il raggio dell'orbi- 
ta planetaria, l'orbita verrà sensibilmente 
deformata dal campo gravitazionale della 
stella che passa e il pianeta può essere 
disperso nello spazio, il tempo medio di 
attesa di un tale incontro dipende dalla 
densità delle stelle in una data regione, 
dall'area delle orbite planetarie e dalla 
velocità relativa delle stelle. La densità 
delle stelle si può esprimere in funzione 
del volume nel quale esiste la probabilità 
di trovare almeno una stella. Una stella 
che si muove nello spazio con un pianeta 
traccia un volume cilindrico le cui dimen- 
sioni dipendono dall'area dell'orbita del 
pianeta e dalla velocità della stella. L'in- 
tervallo medio tra due incontri di stelle è 
uguale al tempo necessario perché il vo- 
lume del cilindra diventi uguale al volume 
nel quale ci si può aspettare una stella 
(si veda lo schema a pagina 76). 

La densità delle stelle in una galassia è 
di una stella per 35 anni luce cubi. Free- 
man 1. Dyson dell'Insolute for Advanced 
Study di Princeton avanza l'ipotesi che un 
valore ragionevole del raggio di un'orbita 
planetaria è di circa 100 milioni di chilo- 
metri e fa notare che una tipica stella tra- 
scina i suoi pianeti nello spazio a una ve- 



74 




La frequenza degli incontri tra una stella e un sistema planetario può essere stimata dal numero di 
stelle per unità di volume, dalle dimensioni del sistema planetario e dalla sua velocità rispetto alle 
stelle. Gli incontri perturbano un'orbita planetaria ogniqualvolta la stella interseca il volume di 
spazio occupalo dall'orbita del pianeta. In media un tale incontro avverrà nello stesso tempo 
necessario perché il sistema planetario tracci un cilindro nello spazio con volume uguale al cubo 
all'interno del quale ci si aspetta di trovare una stella. Esiste una stella nella galassia per ogni 35 
anni luce cubi. Ogni sistema planetario si muove a circa 50 chilometri al secondo e le orbite pla- 
netarie esterne tracciano un cilindro il cui raggio è di circa 100 milioni di chilometri. Con tali pre- 
supposti si può subito calcolare che un incontro si verifica circa ogni IO 1 * anni. Dopo circa 100 
incontri, che si prevedono in IO 17 anni, le orbile dei pianeti saranno state tanto sconvolte che i 
pianeti saranno sfuggili dalla stella madre e si saranno dispersi nello spazio interstellare. La 
scala delle stelle e del sistema planetario rispetto alla loro densità nello spazio è stata esagerala. 



locità di circa 50 chilometri al secondo. Il 
volume del cilindro tracciato dal sistema 
planetario in movimento sarà perciò di 35 
anni luce cubi dopo circa l(r 5 anni e in 
tale intervallo è quindi probabile un in- 
contro distruttivo. Si può supporre con 
certezza che dopo 100 di tali incontri tutti 
i pianeti di una stella siano stati espulsi 
dall'orbita, di modo che in circa 100 volte 
IO 15 anni, cioè IO 17 anni, tutte le stelle 
avranno perso i loro pianeti. 

La terza transizione prevista è il risulta- 
to di incontri stellari ancor più ravvicinati; 
i loro effetti sono evidenti su scala galatti- 
ca. Quando due stelle si avvicinano tra 
loro, l'interazione gravitazionale può tra- 
sferire energia cinetica da una stella all'al- 
tra. Se l'incontro è abbastanza ravvicina- 
to, una stella può acquistare tanta energia 
da raggiungere la velocità necessaria per 
sfuggire dalla galassia. Dato che nell'inte- 
razione si conserva l'energia, la seconda 
stella deve perdere energia cinetica e 
come risultato si lega più strettamente al 
nucleo della galassia. 

Il processo può essere chiamato evapo- 



razione galattica, poiché le interazioni 
stellari riproducono su grandissima scala 
le interazioni delle molecole che evapo- 
rano dalla superficie di un liquido. Uno 
scambio di energìa di questo tipo può 
anche far sfuggire dalla galassia una fra- 
zione apprezzabile del gas interstellare. 
Dopo l'evaporazione di circa il 90 per 
cento della massa della galassia, il campo 
gravitazionale trascinerà le stelle e la pol- 
vere rimanenti in un nucleo sempre più 
denso. È probabile che le galassie nella 
loro forma attuale comprendano un buco 
nero centrale supermassivo, una regione 
di spa/iii dalla quale è impossibile sfuggi- 
re (tranne che con i meccanismi descritti 
dalla teoria dei quanti). Se oggi questo 
buco nero non esiste, il nucleo galattico 
crescerà probabilmente ancora, diven- 
tando talmente denso che la gravitazione 
vincerà la resistenza offerta dalla pressio- 
ne del gas e il nucleo collasserà comunque 
per formare un buco nero supermassivo. 
Un calcolo simile a quello che abbiamo 
indicato per la perdita dei pianeti mostra 
che l'evaporazione delle stelle e il collasso 



delle galassie dovrebbero completarsi 
dopo circa IQ 1M anni. 

La quarta e la quinta transizione che 
J immaginiamo per l'universo aperto 
sono effetti cosmologici ritardati previsti 
dalla maggior parte dei modelli di grande 
unificazione della fìsica delle particelle, 
ma tali effetti non diventano importanti 
fino a quando l'universo non ha un'età 
100 volte maggiore di quella in cui le ga- 
lassie collassano. L'obiettivo delle teorie 
di grande unificazione è di presentare una 
spiegazione che comprenda le forze forte, 
debole ed elettromagnetica tra le particel- 
le elementari. Alle energie relativamente 
basse raggiungibili nei laboratori terrestri 
le tre forze appaiono del tutto diverse; cio- 
nonostante, le suddette teorie le descrivo- 
no come manifestazioni di una sola intera- 
zione, la cui unità si può percepire all'e- 
nergia corrispondente a una temperatura 
dell'ordine di IO 27 kelvin. A tale straordi- 
naria temperatura particelle quali i quark. 
che «sentono» la forza forte, si possono 
trasformare in particelle quali l'elettrone e 
il positone, che a energie minori sentono 
soltanto le forze debole ed elettromagneti- 
ca. A temperature inferiori tali cambia- 
menti di identità diventano altamente im- 
probabili, ma possono ancora verificarsi 
occasionalmente. Il protone potrebbe de- 
cadere se i suoi tre quark costituenti subis- 
sero una trasformazione. 

Secondo la maggior parte delle teorie 
di grande unificazione, tutti i protoni 
dovrebbero decadere dopo un periodo di 
IO 30 - IO 32 anni; un tasso di decadimento 
di almeno un protone all'anno dovrebbe 
perciò venire registrato in qualsiasi ag- 
gregato che contenga IO 33 protoni, quale 
una massa d'acqua che pesa circa 160 
tonnellate. Vi sono oggi 13 esperimenti, 
o in atto o in studio, che tentano di con- 
trollare grandi masse d'acqua, di ferro o 
di altri materiali per evidenziare il deca- 
dimento del protone. Segnali di decadi- 
mento sono stati probabilmente identifi- 
cati da 150 tonnellate di ferro controllate 
a 2300 metri di profondità nel campo 
aurifero di Kolar presso Bangalore nel- 
l'India meridionale. Un unico segnale di 
decadimento è stato registrato dai rivela- 
tori installati nel tunnel del Monte Bian- 
co tra la Francia e l'Italia. È troppo pre- 
sto per giudicare se tali segnali resiste- 
ranno alle analisi. 

Se il protone è suscettibile di decadi- 
mento, il processo avrà un effetto signifi- 
cativo sulle stelle che non sono state cat- 
turate da buchi neri galattici. Tali stelle 
sono le sole che sfuggono per evaporazio- 
ne e il decadimento dei protoni e dei neu- 
troni in esse le manterrà notevolmente 
più calde del mezzo interstellare circo- 
stante. Ammettendo una vita media del 
protone di IO 3 " anni, il tasso di decadi- 
mento di una tipica stella con le stesse 
dimensioni del Sole è di circa IO 27 all'an- 
no. Ogni decadimento di un protone dà 
origine a uno sciame di elettroni, positoni, 
neutrini e fotoni energetici. Tutte le parti- 
celle figlie, tranne i neutrini, vengono 
assorbite dalla stella e questa energia as- 
sorbita mantiene calda la stella. 



O i può determinare l'esatta temperatura 
" della stella durante l'era di decadi- 
mento dei protoni uguagliando il tasso di 
irraggiamento di energia dalla stella al 
tasso di liberazione di energia termica da 
parte del decadimento. In questo stato di 
equilibrio, la temperatura dipende dalla 
massa della stella, dalla superficie dalla 
quale può essere irraggiato il calore e dal- 
l'energia di riposo e dalla vita media del 
protone. La temperatura di equilibrio è di 
1 00 kelvin per le stelle morte con maggior 
massa (che. paradossalmente, sono le più 
piccole) e di circa tre kelvin per le stelle 
più grandi e con minor massa. 

Le stelle si raffredderanno alla loro 
temperatura di equilibrio in circa IO 20 
anni e da quel momento in poi la loro 
temperatura si manterrà pressoché co- 
stante finché verso l'anno IO 30 sarà deca- 
duta la maggior parte dei protoni. Il ba- 
gliore stellare e freddo, ma non in con- 
fronto alla temperatura della radiazione 
di fondo residua del big bang. La tempe- 
ratura di fondo dipende dai particolari 
della espansione dell'universo aperto. Se 
la densità dell'universo è minore di quella 
critica, la temperatura della radiazione di 
fondo sarà scesa a 10' 2n kelvin entro l'an- 
no IO 3 ". Se invece la densità è esattamen- 
te uguale a quella critica, l'universo si sarà 
espanso più lentamente e la temperatura 
della radiazione di fondo sarà scesa a 
IO" 13 kelvin. Cioè, la temperatura sarà da 
13 a 20 ordini dì grandezza inferiore alla 
temperatura delle stelle morte. 

TI decadimento del protone fa anche 
A cambiare la costituzione dei gas inter- 
stellari che evaporano prima che le galas- 
sie collassino. All'interno di una stella un 
positone liberato dal decadimento di un 
protone incontra subito un elettrone e le 
due particelle si annichilano. L'annichila- 
zione produce altri fotoni e riscalda la 
stella. Nello spazio intergalattico la densi- 
tà della materia è così bassa (e in continua 
diminuzione a causa dell'espansione del- 
l'universo) che è estremamente improba- 
bile che positoni ed elettroni entrino in 
collisione. In effetti, entro l'anno 1 30 un 
universo aperto con una densità inferiore 
a quella critica si sarà espanso a più di 
i0 J " volte le sue dimensioni attuali e la 
distanza media tra un elettrone e un posi- 
tone nel mezzo interstellare sarà dello 
stesso ordine di grandezza delle dimen- 
sioni della nostra galassia. (Se la densità 
dell'universo è uguale a quella critica, l'u- 
niverso si sarà espanso di un fattore IO 13 .) 
II mezzo interstellare diventa perciò un 
gas estremamente rarefatto formato da 
circa 1,1 per cento degli elettroni di oggi e 
dai positoni creati dal decadimento di cir- 
ca 1" 1 per cento dei protoni di oggi. 

Gli eventi associati al decadimento del 
protone si saranno rivelati quando resi- 
stenza del l'uni verso avrà raggiunto i IO 32 
anni, un arco di tempo 1 00 volte superiore 
alla vita media del protone. Ciò che rimane 
dell'universo a questo punto sono il gas 
rarefatto dì elettroni e positoni. i fotoni e i 
neutrini emessi in varie epoche precedenti 
e i buchi neri supermassivi. I fotoni e i 
neutrini sono residui del big bang, degli 



anni in cui le stelle splendevano, del deca- 
dimento di protoni e neutroni attraverso la 
storia e del decadimento finale di stelle 
morte. I fotoni e i neutrini perdono energia 
e sia essi sia gli altri costituenti diventano 
più rarefatti col continuare della espansio- 
ne. Per altri aspetti l'universo a densità 
inferiore a quella critica resta quiescente 
fino a circa l'anno 10 1()0 , un periodo 10 fiS 
volte più lungo di tutti i processi che ab- 
biamo descritto finora. 

Il sesto e ultimo evento di rilievo nel 
futuro dell'universo aperto è il decadi- 
mento dei buchi neri. Nell'interpretazio- 
ne più semplice della teoria gravitaziona- 
le di Einstein nulla può sfuggire da un 
buco nero. Esiste un confine, chiamato 
orizzonte degli eventi, lungo il quale la 
velocità necessaria per sfuggire è uguale 
alla velocità della luce; nessuna particella 
all'interno dell'orizzonte degli eventi può 
muoversi tanto rapidamente da attraver- 
sarlo. Ciononostante, nel 1974, S. W. 
Hawking dell'Università di Cambridge 
dimostrò che un fenomeno quantomec- 
canico comporta che un buco nero possa 
emettere tutta l'energia associala alla sua 
massa e quindi scomparire. 

Il fenomeno quantomeccanico è una 
conseguenza del principio di indetermi- 
nazione di Werner Heisenberg, secondo il 
quale !a quantità dì moto o la posizione 
di una qualsiasi particella ha soltanto 
una certa probabilità di cadere all'interno 
di un dato intervallo di valori. Più esatta- 
mente, il prodotto dell'indeterminazione 
della quantità di moto della particella per 
l'indeterminazione della sua posizione 
non è inferiore a una costante numerica. 
In fisica classica (cioè, nella teoria fisica 



— A 



che non tiene conto dei fenomeni quanti- 
stici) una particella può attraversare una 
barriera energetica solo se le si conferisce 
energia sufficiente a superare tale barrie- 
ra. L'orizzonte degli eventi è in fisica clas- 
sica una barriera energetica assoluta: una 
particella non potrebbe acquistare ener- 
gia sufficiente a superarlo. Invece, a causa 
del principio di indeterminazione, una 
particella che si trova inizialmente in una 
regione può trovarsi successivamente in 
un'altra regione, anche se la sua energia 
classica è molto inferiore all'altezza della 
barriera energetica tra le due regioni. Si 
dice che una particella, che attraversa una 
barriera energetica in questo modo, senza 
acquistare l'energia necessaria a superar- 
la, ha attraversato la barriera per effetto 
tunnel. Hawking sottolineò che, dal 
momento che le particelle possono attra- 
versare l'orizzonte degli eventi per effetto 
tunnel, da un buco nero possono essere 
espulse massa ed energìa {si veda l'artico- 
lo La meccanica quantistica dei buchi neri 
diS. W. Hawking, in «Le Scienze», n. 105, 
maggio 1977). 

Hawking dimostrò che il tasso di emis- 
sione di energia da un buco nero è 
inversamente proporzionale al quadrato 
della sua massa, II tasso è inizialmente 
basso ma, al diminuire della massa, la 
perdita di energia aumenta. Ne consegue 
che tutti i buchi neri devono alla fine 
scomparire o evaporare: per i buchi neri 
supermassivi, resti di galassie col lassate, 
il tempo di evaporazione è di circa IO 1 "" 
anni. La maggior parte dei prodotti di 
decadimento sono fotoni; l'emissione 
diventa sempre più energetica negli ulti- 






II decadimento del protone è un possibile evento che dovrebbe avere conseguenze importanti per 
il futuro dell'universo. Esso dovrebbe osservarsi sperimentalmente se non è troppo raro. La 
maggior parte delle attuali «leu rie di grande unificazione» delle interazioni tra particelle elementa- 
ri prevede che la durata della vita del protone sia compresa tra IO- 1 " e 10 3: anni. Ben D esperimenti in 
corso o in fase di progettazione stanno cercando di identificare il decadimento. Sono all'esame 
alcuni eventi, che potrebbero essere dì decadimento, registrati in due esperimenti. Alcuni di questi 
eventi sono stati rivelati da ricercatori che operano in una miniera nei campi auriferi di Kolar nei 
pressi di Bangalore nell'India meridionale; un altro evento è stato visto da ricercatori che operano 
presso l'Organizzazione europea per le ricerche nucleari (CERN}„ che lavorano con un rivelatore 
installatone! tunnel del Monte Bianco I ra la Francia e l'Italia. L'evento del Monte Bianco è illustrato 
in due vedute schematiche, che risultano una perpendicolare all'altra. I piani paralleli sono lastre di 
ferro controllate per eventuali decadimenti e le macchie nere rappresentano i prodotti del 
decadimento. Se si riesce a verificare il decadimento del protone, sì può fissare una pietra miliare 
dell'evoluzione dell'universo attorno all'anno IO 30 . A quel tempo sarà decaduta tutta la mate- 
ria a lunga vita, fatla eccezione per gli elettroni, i positoni, i fotoni, i neutrini e i buchi neri. 



76 



77 



mi stadi dell'evaporazione. Perciò, dopo 
IO 100 anni, l'universo è costituito da un 
arem amente diffuso di elettroni, 
positoni e neutrini, da fotoni di bassa 
energia emessi molto tempo prima del 
decadimento dei buchi neri e da numero- 
se sfere in espansione di fotoni di alta 
energia emessi dall'evaporazione di bu- 
chi tv. 

I modelli matematici della struttura su 
grande scala di un universo aperto indica- 
no che l'universo nel quale viviamo si tro- 
va in una condizione mollo particolare. 
Per descrivere matematicamente l'uni- 
verso si devono precisare sei grandezze: 
tre danno la velocità di espansione lungo 
le tre direzioni dello spazio e tre danno il 
lasso di variazione della velocità di espan- 
sione (la sua accelerazione o decelerazio- 
ne) lungo le tre direzioni. Se le sei gran- 



io 24 



dezze si definiscono in un certo istante e 
se si procede in questo istante alla distri- 
buzione di energia, si possono determina- 
re tali valori e la distribuzione energetica 
in tutti gli istanti successivi. 

Nel 1973 Hawking e C.B.Collins, pure 
di Cambridge, dimostrarono, che per 
quasi tutti i valori possibili di queste gran- 
dezze in una fase primitiva durante il big 
bang, l'universo deve diventare sempre 
più anisotropo mentre si espande. La di- 
stanza media delle galassie lungo un asse 
spaziale dovrebbe diventare sempre più 
diversa dalla distanza media lungo gli altri 
assi a causa delle differenze nelle velocità 
di espansione. Il risultato fa pensare che 
l'attuale universo sia estremamente im- 
probabile. Per esempio, come abbiamo 
fatto notare prima, il fondo cosmico a 
microonde è invariante con la direzione 



entro una parte su 10 000 Su scala co- 
smica, anche la materia dell'universo è 
distribuita regolarmente. Un altro pro- 
blema irrisolto della cosmologia è quello 
di capire perché l'universo sia in questo 
modo quasi isotropo. 

Un modo di affrontare il problema è di 
scegliere valori iniziali delle sei gra- 
dezze in modo tale che la densità di ener- 
gia della materia e della radiazione sia 
esattamente uguale alla densità critica. Se 
nella sua storia un siffatto universo è do- 
minato dalla materia anziché dalla radia- 
zione, qualsiasi anisotropia iniziale non 
potrà accrescersi. II decadimento del pro- 
tone, però, può portare a un universo 
dominato dalla radiazione. 

John D. Barrow e Frank J. Tipler del- 
l'Università della California a Berkeley 



a 

3 



1 « 
< 



8 



5 10" 

> 



d 10» 
o 
o 
a 

I i 



10 



il 






















































































^^"■■^^ 


































































































































































































































































































































































































— 


1 i 


































































































































































^ 




-^ 






















































































IO 1 


IO 3 




10 3 

ANN1- 


10 6 1 SECONDO IO 3 10" 6 10" 9 10 ,2 IO 15 10 ,B 
=H SECONDI > TEMPO FINO AL -BIG CRUNCH- ■ 


10 =< 


10" M 10 -v 10" w 


10"" 








1 



























































hanno dimostrato che in un universo alla 
densità critica gli elettroni e i positoni che 
rimangono dopo il decadimento de! pro- 
tone cominceranno a formare coppie le- 
gate dopo più di 1 70 anni. Ogni coppia 
legata è in realtà un atomo, ma l'elettrone 
e il positene orbitano ciascuno in uno sta- 
to così altamente eccitato che la regione 
di spazio occupata dalla coppia è più este- 
sa dell'universo attualmente osservabile. 
Lo spazio occupato diventa tanto più 
grande quanto più tardi si forma una cop- 
pia legata. 

Col passar del tempo l'elettrone e il 
positone si muovono a spirale verso l'in- 
terno e finiscono con l'annichilarsi, dando 
origine a fotoni di alta energia. La lun- 
ghezza d'onda dei fotoni viene spostata 
verso l'estremità rossa dello spettro men- 
tre l'universo continua a espandersi. Nel 



ì tr- 



io» g 

3 

a 

o 
■ 
F 

I 

z 

Ui 

o 

■ 

- IO' 5 ol 

2 
1 

3 

ce 
9 

io- 5 r 



-" 10 



FOTONE - \ 



ELETTRONE 




IDRf 
ATOMICO 



PROTONE 



RADIAZIONE DI FONDO 



\ 



STELLA 



-<s> 



\. 



PROTONE 





\ 



lf- 






BUCO NERO è 
fi 



POLVERE 




COLLASSO 
UNIVERSALE 



BUCHI NERI 

CHE SI RAGGRUPPANO 




UNIVERSO 
AL TEMPO T 



UNIVERSO 

AL TEMPO T + t 



Le Tasi finali del collasso di un universi) chiuso ripercorrerebbero 
aH*incirt:i le slesse fasi della sua espansione se non vi fossero gli effetti 
dei buffai neri. C'irci 20 miliardi di anni prima del «big eninch», il 
collasso gravilH/iunale completo di un universo chiuso, l'universo si 
contrarra in un volume nel quale la sua densità di energìa sarà la stessa 
di oggi- Mentre la contrazione continuerà, i rotimi diventeranno più 
energetici e l'universo si riscalderà; circa un milione di anni prima del 



«big crunch» i fotoni dissoci e ranno gli atomi di idrogeno interstellari 
nei loro elettroni e protoni. Un anno prima, invece, la temperatura 
all'esterno delle stelle diventerà maggiore di quella interna e le stelle 
cominceranno a spaccarsi. Circa nello stesso tempo i buchi neri super- 
massivi cominceranno a inghiottire il materiale stellare restante, come 
pure altra materia e radiazione. Circa tre minuti prima, infine, i bu- 
chi neri supermassivi cominceranno a raggrupparsi e questo loro rag- 



gruppamento è rappresentalo dalla contrazio- 
ne della superficie di una sfera, che corrispon- 
de alla contrazione dello spailo. La variazione 
di densità e di raggio dell'universo è rappresen- 
tala in funzione del tempo; essa è stala calco- 
lala numericamente applicando le equazioni 
di Einstein e altri principi descritti nel (esito. 



modello descritto da Barrow e Tipler esso 
finisce con l'essere dominato dalla radia- 
zione e l'anisotropia aumenta. Tuttavia, 
in una ricerca successiva. Don N. Page e 
M. Randall McKee della Pennsylvania 
State University dimostrarono che in cer- 
te condizioni le coppie elettrone-positone 
possono continuare a dominare l'energia 
dell'universo anche se il loro numero è in 
diminuzione. Lo spostamento verso il 
rosso della radiazione di fotoni fa dimi- 
nuire la sua energia e il lungo tempo pro- 
gressivamente crescente per l'annichila- 
zione di coppie legate, di formazione ri- 
tardata, provoca una diminuzione nel tas- 
so di emissione dei fotoni. Quindi può 
darsi che l'anisotropia caratteristica di un 
universo che è dominato dalla radiazione 
non sia più in grado di crescere. 

Tutte le speculazioni precedenti ri- 
guardano un universo aperto. Analizze- 
remo ora il futuro dell'universo nell'ipo- 
tesi che vi sia sufficiente materia non lu- 
minosa perché la gravità arresti l'espan- 
sione e origini una contrazione. Quanto 
più la densità media è vicina a quella criti- 
ca, tanto più a lungo durerà l'universo 
chiuso. Non conosciamo però alcun moti- 
vo per il quale la densità media debba 
essere abbastanza vicina alla densità criti- 
ca da permettere all'universo di sopravvi- 
vere fino a che non decadrà la maggior 
parte dei protoni. È perciò probabile che 
l'universo, nella sua massima espansione, 
sia formalo da stelle morte, da buchi neri 
supermassivi, resti dì galassie collassate, e 
da fotoni e neutrini dotati di bassa ener- 
gia, proprio come accadrebbe se l'univer- 
so fosse aperto. 

Un aspetto curioso di un universo chiu- 
so è che, anche se l'energia si conser- 
va localmente, la massa o l'energia totale 
dell'universo non si conserva. Per una 
data dimensione dell'universo l'energia 
totale durante la contrazione è maggiore 
che durante l'espansione. Si consideri un 
fotone emesso dal Sole verso Io spazio 
intergalattico. 

Il principio di conservazione viene sod- 
disfatto durante l'emissione perché l'e- 
nergia trasportata dal fotone è esattamen- 
te bilanciata da una piccolissima diminu- 
zione della massa del Sole, Mentre l'uni- 
verso si espande, la lunghezza d'onda del 
fotone aumenta proporzionalmente, con 
il risultato che la sua energia diminuisce. 
Quando l'universo si contrae, diminuisce 
anche la lunghezza d'onda del fotone e la 
sua energia per contro aumenta. 

Alla fine la lunghezza d'onda del foto- 
ne diventa inferiore a quella che il fotone 
possiede all'istante dell'emissione, e 
quindi il fotone ha acquistato energia sen- 
za alcuna corrispondente perdita di massa 
o di energia in altre regioni. L'universo si 
mantiene perciò più caldo durante la con- 
trazione che non durante l'espansione. I 
fotoni che danno il maggior contributo 
all'energia supplementare sono quelli 
emessi quando l'universo si trova alle sue 
massime dimensioni o quasi, dato che tali 
fotoni subiranno la massima contrazione. 

Gli eventi più importanti durante la 
fase di un universo chiuso seguono la 




TECNOLOGIA 



1 1 V, S( . I K N /, I \ edizione italiana di 

S< I i:\TIIK tMERICAN 

ha pubblicato su questo argo- 
mento numerosi articoli tra cut: 



TECNOLOGIA E PAESI 
IN VIA DI SVILUPPO 

di Ci 



AUTOMATISMI 
dì J. S. Aibusé I M I n c i4) 



IL SISTEMA MONDIALE 

DI TELECOMUNICAZIONI 

VIA SATELLITE 

di B. 1. Edelson 



GLI IMPIEGHI DELLA RADIAZIONE 
DI SINCROTRONE 

di E L Rowe e I 1 1 Weavcr (n. 110) 

COMUNICAZIONI 
SU ONDA LUMINOSA 
di W. S, Bayle (n, 112) 



COME CONSERVARE L'ENERGIA 
di G. B. Zorzo! 



MONTAGGIO GUIDATO 
DAL CALCOLATORE 

di J. L. Nevins e I 



LA CONVERSIONE BIOLOGICA 
DELL'ENERGIA SOLARE 

di I F. Quercia e P Quercia (n 119) 



PROGETTI ALTERNATIVI 

PER IL MOTORE D'AUTOMOBILE 

di D. G. Wilson (ti. 121) 



APPLICAZIONI INDUSTRIALI 

DELLE MEMBRANE SINTETICHE 

di H. P.GregOTeC. I 1 I2li 



LA CENTRIFUGAZIONE 

GASSOSA 

di Donald R Olande] fa 122) 



78 



79 




TEMPO 




LUNGHEZZA D'ONDA 




' 




• C 




< 








19 




\ A 




.r 








z 






B 


UJ 













LUNGHEZZA D'ONDA 



LUNGHEZZA D'ONDA 



Le ene rgie delle particene libere non si consertano in un universo chiuso. 
A causa dell'espansione e della contrazione cosmica di un I ale universo, i 
fenomeni che dipendono dalla distanza variano nel tempo, allo stesso 
modo in cui la disianza tra due punti sulla superficie di un pallone 
aumenta o diminuisce quando il pallone si gonfia <> si sgonfia, Cosi la 
lunghezza d'onda di \ir. fatane aumenta durante l'espansioni,- e djiitiuui- 



sce durante la contrazione. L'energia del fotone è proporzionale all'in- 
verso della lunghezza d'onda e quindi l'energia del fotone emesso 
diminuisce durante l'espansione e aumenta duranle la contrazione. 
Quando la lunghezza d'onda del fotone è minore di quella all'istante 
della sua emissione, l'universo ncll' insieme acquista energia. L'ener- 
gia uùui/iiiiiaie poireijòe originare una nuova, successiva espansione. 






stessa successione degli eventi in un uni- 
verso aperto. (Non esiste, naturalmente, 
alcun collasso per un universo aperto.) 
Numerosi ricercatori tra i quali Martin J. 
Rees di Cambridge, hanno studiato il col- 
lasso. Mentre i fotoni acquistano energìa 
durante la contrazione, essi riscaldano le 
stelle morte, provocando in tal modo l'i- 
nizio di una loro rapida combustione. 
esplosione o evaporazione. 

Il risultante «brodo» di particelle con- 
tinuerebbe a ripetere le varie fasi dell'e- 
spansione dell'universo se non fosse per 
gli effetti dei buchi neri. All'aumentare 
della densità, i buchi neri ingoiano mate- 
ria e si fondono quando si scontrano. Si 
può calcolare che in un universo con un 
buco nero supermassivo per galassia le 
stelle morte vengano inghiottite dai bu- 
chi neri subito dopo che si spezzano e da 
esse comincia a evaporare materia. Alla 
fine tutti i buchi neri si riuniscono in un 
solo grande buco nero che abbia la stessa 
ampiezza dell'universo. 

La fisica teorica nel suo attuale stato di 
sviluppo non può descrivere completa- 
mente il collasso di un buco nero; non si sa 
ancora come estrapolare le equazioni che 
governano la struttura su grande scala 
dell'universo fino a riportarla a uno stato 
di densità infinita. È però possibile che, 
prima che la densità diventi infinita, un 
meccanismo sconosciuto induca una 



«inversione di rotta» e faccia si che Funi- 
verso ricominci ancora a espandersi. 

Se l'universo può invertire rotta, esso 
potrebbe rimanere chiuso e quindi essere 
ciclico. L'energia acquistata dai fotoni 
durante ogni periodo di contrazione po- 
trebbe conservarsi durante l'inversione; 
con ogni successivo ciclo l'universo diven- 
terebbe perciò più grande, per una data 
temperatura, di quanto non fosse nel ciclo 
precedente e impiegherebbe anche più 
tempo per raggiungere le sue massime 
dimensioni. Robert H. Dicke e P. J, E. 
Peebles della Princeton University assie- 
me a noi quattro hanno calcolato che, se 
l'universo e ciclico, il prossimo ciclo do- 
vrebbe espandersi per una durata doppia 
delia fase di espansione del ciclo attuale. 
Per i cicli precedenti il fattore di espansio- 
ne sarebbe minore; abbiamo calcolato che 
l'universo attuale si trova al massimo a 1 00 
inversioni dal ciclo che È durato appena da 
produrre una sola generazione di stelle. La 
maggiore difficoltà del modello per le in- 
versioni è quella di capire come un univer- 
so straordinariamente disomogeneo e lo- 
calmente anisotropo, costituito da buchi 
neri che si stanno gradatamente raggrup- 
pando, possa diventare regolare; per tale 
motivo non si riesce a capire come possa 
avvenire un'inversione. 

Se l'universo è cìclico, e se le reazioni 
mediate dalle alte temperature esistenti 



all'inizio di ogni ciclo danno origine all'ec- 
cesso di particelle nucleari sulle antiparti- 
celle, oggi osservato, si può trarre un'im- 
portante conclusione. L'evoluzione del- 
l'universo dall'inizio dì ogni inversione, 
fino alla formazione e alla dissoluzione del- 
le galassie, seguirà lo stesso corso di eventi 
durante ogni ciclo. Tuttavìa, all'allungarsi 
dei cicli, i fenomeni che abbiamo descritto 
per i successivi stadi dell'universo aperto 
diventeranno importanti. Per esempio, nel 
primo ciclo in cui la fase di espansione dura 
più di un deci miliardesimo della vita media 
del protone (cioè, più di circa IO 20 anni) 
l'energia acquistata durante la fase di con- 
trazione sarà dominata dai fotoni emessi 
nel corso del decadimento del protone. I 
cicli successivi possono perciò diventare 
più lunghi di un fattore pari a 1000 anziché 
di un fattore soltanto di 2 circa. Dagli effet- 
ti di raggruppamento di buchi neri potreb- 
bero risultare fattori di espansione perfino 
maggiori, dell 'ordine di IO 11 . 

Da un punto di vista umano forse la 
domanda più importante che ci si 
potrebbe porre sull'universo riguarda il 
futuro della vita e dell'intelligenza. In un 
universo sempre più ostile alla vita, può 
continuare indefinitamente l'abitudine di 
pensare come accade sulla Terra? Nume- 
rosi cosmologi, tra i quali si ricordano 
Dyson e Steven C. Fraucschi del Califor- 



80 




La crisi energetica cosmica potrebbe essere molto ritardata dall'esistenza di buchi neri formati da 
galassie in fase ili collasso. In teoria l'energia potrebbe essere WtWlWw dal camini gnrt iia/imialc ili 
un buco nero; è quindi ammissibile che una civiltà progredita possa mantenersi per almeno 10 IM> 
anni, cine per il tempo necessario ai buchi neri per evaporare. Lo schema conosciuto più efficace 
per estrtirre energia da un buco nero è quello proposto da Charles W, Misner dell'Università del 
Man land di College Park, da Kip S, Thorne del California Institute of Technologv e da John 
Xrchibald Wheeler dell'Università del Texas ad Austin. Attorno a un buco nero in Unt a rlo » » viene 
costruito un guscio rigido e il materiale di scarto della civiltà viene spedito con un satellite vicino 
all'orizzonte degli eventi, il confine della regione dalla quale nulla può sfuggire. Nei pressi 
dell'orizzonte degli eventi il materiale viene scaricato all'equatore del buco nero. Il risultato è che 
tanto l'energia potenziale gravitazionale del materiale scaricalo quanto l'energia rotazionale del 
buco nero sono diminuite. Dato che l'energia totale del satellite e del buco nero deve conservarsi, 
l'energia del satellite aumenta di una quantità pari alla somma delle due diminuzioni ener- 
getiche. In teoria l'energia acquistata dal satellite potrebbe trasformarsi in una forma utile. 




L'universo può essere ciclico, se la densità della materia è sufficiente a chiuderlo e i processi fisici 
finora sconosciuti permettono all'universo di «invertire la rotta», cioè di espandersi ancora. Dato 
che durante la fase di contrazione si acquista energia, ogni nuovo ciclo ha una fase di espansione 
più lunga della precedente. Il periodo di espansione dovrebbe aumentare di un fattore fine arca 
durante il prossimo ciclo dell'universo, supponendo che l'espansione attuale continui per circa 
100 volte t'attuale età dell'universo. La durata dei cicli successivi aumenta di fattori maggiori. 



nia Institute of Technology, hanno co- 
minciato a speculare su temi come il fab- 
bisogno energetico per una con se nazio- 
ne indefinita della vita e per le comunica- 
zioni tra i vari membri di una società di- 
spersa in regioni di spazio con dimensioni 
sempre più grandi. 

Secondo Dyson la vita e Ja coscienza 
non sono necessariamente presenti solo 
all'interno delle cellule e nel DNA: anzi, 
egli sostiene, l'aspetto essenziale della 
coscienza è la complessità di struttura, 
che può essere realizzata in qualsiasi ma- 
teriale di natura opportuna. Così egli so- 
stiene che l'idea di un calcolatore che sen- 
te o di una nuvola che sente non si può 
semplicemente scartare come incoerente 
da un punto di vista filosofico. 

Con tali ipotesi, le variazioni nell'am- 
biente causate dalla morte e dal raffred- 
damento delle stelle e dalla loro evapora- 
zione dalle galassie non dovrebbero esse- 
re insormontabili per un sistema che può 
essere considerato vivente e intelligente. 
Per esempio, in linea di principio, si po- 
trebbe estrarre energia dal campo gravi- 
tazionale di un buco nero supermassivo. 
Tuttavia il decadimento di protoni e neu- 
troni può portare a un cambiamento fon- 
damentale, dato che sembra improbabile 
(anche se forse non del tutto impossibile) 
che l'intelligenza possa basarsi sulle debo- 
li fondamenta di elettroni e positoni. Inol- 
tre, se l'universo è chiuso. le condizioni 
necessarie perché possa realizzarsi la vita 
possono esistere soltanto per ceni periodi 
durante ogni ciclo. 

In un universo aperto l'estremo impe- 
dimento alla vita è del lutto diverso. Con 
l'evaporazione dei buchi neri si verifiche- 
rà una carenza di energia cosmica, per- 
ché, mentre continua l'espansione dell'u- 
niverso, le particelle e i fotoni restantì 
perdono energia. Qualsiasi tasso costante 
di consumo di energia da parte delle for- 
me di vita diventerà a tempo debito inso- 
stenibile. D'altra pane. Dyson avanza l'i- 
dea che, ai periodi di consumo, potrebbe- 
ro alternarsi periodi sempre più lunghi di 
ibernazione, durante i quali non viene 
consumata energia. In questo universo 
esiste quindi la possibilità di civiltà di du- 
rata straordinariamente lunga. 

II punto di partenza della cosmologia con- 
temporanea, come abbiamo sottolineato, 
è la teoria del big bang. La nostra trattazione 
quantitativa dell'evoluzione del big bang nel 
futuro remoto si basa sulle nuove teorie che 
descrivono la fisica delle panicelle elemen- 
tari. Queste idee però erano già state espres- 
se nel loro spirito dall'astronomo e poeta 
persiano del secolo XI Omar KhayySm.il cui 
poema Rubdiyàt è stato tradotto dallo scrit- 
tore inglese Edward FitzGerald. In una 
qua ni ti a Omar scrisse: 
Con il primo fango della terra fecero 

l'impasto dell'ultimo uomo, 
E poi gettarono il seme 

dell'ultima messe: 
SI, il primo giorno della creazione 

scrisse 
Ciò che l'ultima alba del giorno del 
giudizio 
leggerà. 



82 



Reazioni chimiche oscillanti 

Un tempo ritenute contrarie alle leggi naturali, è stato invece 
possibile realizzarle di recente in laboratorio; sembra che 
possano chiarire analoghi comportamenti nei sistemi viventi 

di Irving R. Epstein. Kenneth Kustin, Patrick De Kepper e Miklós Orbàn 



Ovunque in fisica, in astronomia e 
in biologia si trovano fenomeni 
oscillanti, o periodici. Essi van- 
no dal familiare movimento del pendolo e 
delle orbite dei pianeti ai complessi oro- 
logi biologici che governano il compor- 
tamento giornaliero e stagionale degli 
organismi viventi. Fino ad epoca recente. 
invece, i chimici credevano che le reazioni 
che avvengono nelle provette e nei bic- 
chieri da laboratorio fossero singolar- 
mente immuni da quell'andamento pe- 
riodico che è così familiare in altri settori 
della scienza. Infatti la maggior parte dei 
chimici formatisi prima del 1950 era pro- 
babilmente convinta che, per una miscela 
di sostanze inorganiche semplici, il parte- 
cipare a una reazione che oscillava in 
modo visibile e periodico sarebbe stato 
una evidente violazione di una immutabi- 
le legge di natura. Anche oggi si suppone 
abitualmente che le reazioni chimiche 
siano unidirezionali; se due sostanze rea- 
giscono per darne una terza, ci si aspetta 
che la reazione continuerà regolarmente 
fino all'esaurimento dei reagenti o al rag- 
giungimento di uno stato di equilibrio. 
Normalmente non ci si aspetta che le con- 
centrazioni dei prodotti intermedi della 
reazione raggiungano un certo livello, 
quindi scendano a un livello inferiore per 
risalire poi e di nuovo abbassarsi ripetu- 
tamente, finché si formano prodotti stabi- 
li resistenti a successivi cambiamenti. 

Benché resoconti di tali reazioni appa- 
rissero sporadicamente nella letteratura 
chimica della fine del l'Ottocento e degli 
inizi del Novecento, essi furono respinti 
dalla larga maggioranza dei chimici come 
fenomeni non riproducibili, che potevano 
essere attribuiti probabilmente a processi 
estranei, come la corrosione, o la forma- 
zione di pellicole, che avvenivano nel cor- 
so della reazione. Negli ultimi 25 anni, 
tuttavia, lo studio delle reazioni chimiche 
oscillanti ha finalmente conquistato ri- 
spettabilità e ora costituisce uno dei cam- 
pi della chimica in più rapido sviluppo. Lo 
studio promette di penetrare nella dina- 
mica chimica e nei meccanismi di catalisi e 
forse nei fenomeni periodici ancora oscu- 
ri che si osservano in biologia e in geolo- 



gia. Mentre il primitivo piccolo gruppo di 
reazioni chimiche oscillanti fu trovato per 
caso, è ora possìbile descrivere le condi- 
zioni che contribuiscono all'oscillazione e 
preparare una ricerca sistematica di nuovi 
sistemi oscillanti. Si tratta di una ricerca 
che ha già dato i suoi frutti. 

La riluttanza dei chimici ad accettare la 
realtà delle reazioni oscillanti può essere 
fatta risalire principalmente al secondo 
principio della termodinamica. Nella sua 
formulazione più nota, dovuta al fisico 
[edesco Rudolf ( lausius nel N!\ secolo, 
il secondo principio stabilisce che l'entro- 
pia, ossia la casualità, dell'universo tende 
ad aumentare. Applicato alle reazioni 
chimiche, il principio richiede che un si- 
stema chimico, in assenza dì apponi 
esterni di materia o di energia, deve con- 
tinuamente tendere a uno stato finale di 
equilibrio. Cioè, se A va verso B, deve 
essere così per tutta la durata della rea- 
zione senza deviazioni a ritroso verso A 
lungo il percorso. Si pensava che le rea- 
zioni in cui questa regola sembra essere 
violata dovessero derivare o da uno scar- 
so controllo delle condizioni sperimenta- 
li, o da qualche artificio voluto, dal mo- 
mento che esse costituirebbero una sorta 
di macchina chimica a moto perpetuo. 

Si può pertanto immaginare l'indiffe- 
renza con cui fu accolta la relazione su 
una reazione oscillante pubblicata nel 
1921 da William C. Bray dell'Università 
della California a Berkeley. Studiando il 
ruolo dello iodato, ione dello iodio ossi- 
genato (IOr), come catalizzatore della 
decomposizione dell'acqua ossigenata, o 
perossido di idrogeno, in acqua e ossige- 
no. Bray osservò che, in determinate con- 
dizioni, la velocità di produzione dell'os- 
sigeno e la concentrazione dello iodio nel- 
la soluzione cambiavano periodicamente. 
All'osservazione di Bray fu prestata scar- 
sa attenzione nel corso dei successivi cin- 
quant'anni. I pochi articoli che apparvero 
sulla reazione di Bray tentavano in gran 
parte di spiegare le oscillazioni come arte- 
fatti dovuti a polvere o a impurità più che 
di esaminare ulteriormente il fenomeno. 
Come vedremo, lo iodio e gli ioni ioduro 



(I) e iodato svolgono un ruolo importante 
in molti sistemi oscillanti messi a punto di 
recente. L'era moderna per quanto ri- 
guarda lo studio di reazioni chimiche oscil- 
lanti può essere fatta partire da una scoper- 
ta accidentale dovuta nel 1 958 al chimico 
sovietico B. P. Belousov. Egli osservò che, 
se si sciolgono in acqua acido citrico e aci- 
do solforico con bromato di potassio e un 
sale di cerio, la soluzione varia periodica- 
mente da incolore a color giallo chiaro. Col 
1958, dunque, alcuni chimico-fisici, alme- 
no, furono disposti a considerare seria- 
mente la notizia, sia perché la reazione di 
Belousov era facilmente ripetibile, sia per- 
ché i concetti di termodinamica del XIX 
secolo erano stati estesi dopo la seconda 
guerra mondiale. 

Il primo in questo impegno fu Ilya Pri- 
gogine della Universi té libre di Bruxelles, 
il quale riconobbe che la termodinamica 
classica di Clausius richiedeva non solo che 
i sistemi fossero isotati dall'ambiente, ma 
anche che fossero vicini al loro staio di 
equilibrio. Per sistemi lontani dall'equili- 
brio, sia perché una reazione è solo ai primi 
stadi, sia perché il sistema è «aperto», e 
pertanto soggetto a un flusso di energia 
dall'esterno. Prigogine e i suoi collabora- 
toci svilupparono il concetto di una termo- 
dinamica irreversìbile. Per questo lavoro, 
nel 1977, Prigogine ha ricevuto il premio 
Nobel per la chimica. 

In sistemi lontani dall'equilibrio, posso- 
no presentarsi molti nuovi fenomeni, de- 
scritti come strutture dissìpative. Tali strut- 
ture comprendono oscillazioni periodiche 
nelle concentrazioni di specie intermedie 
in una reazione chimica: invece, non sono 
soggetti a oscillazione né i reagenti iniziali, 
né i prodotti finali. 1 viventi costituiscono 
gli esempi più interessanti e vari di sistemi 
oscillami aperti, lontani dall'equilibrio. 
Essi vengono mantenuti in uno stato di 
non equilibrio dall'apporto di reagenti 
(sostanze nutritive) provenienti dall'ester- 
no e dalla produzione di sostanze di rifiu- 
to. Se l'uno o l'altro di questi flussi si arre- 
sta, l'organismo e le sue oscillazioni si 
estinguono. 

Nel 1958, le implicazioni della termo- 
dinamica irreversibile di Prigogine furono 



86 




MI 

■T étÈ. 



. 




Il 




-tm> 


"/ ^N 




L 


j** 


^"*— 


V 


±y 






Un sistema chimico oscillante è fotografato nel laboratorio degli auto- 
ri alla Brandeis University. La reazione procede in un recipiente di 
vetro nel quale vengono pompate tre soluzioni a una velocita costante: 
iodato di potassio, acido perclorico e acqua ossigenata, e acido meta- 
nico con solfalo manganoso monoidrato. L'amido serve da indicatore, 
poiché in presenza di iodio forma un complesso blu scuro, L'intervallo 



fra una fotografia e la successiva, partendo dall'alto a sinistra e proce- 
dendo da sinistra verso destra, è poco meno di Ire secondi (come è 
indicato dalla lancetta dei secondi sull'orologio). Questo particolare 
sistema è stato progettato da due insegnanti di scuola superiore in 
California, Thomas S. Briggs e Warren C. Rauscher. La rea/ione è 
stata modificata per farla avvenire in condizioni di (lusso continuo. 



87 



capite soltanto da pochi chimici. Inoltre, 
ia scoperta di Belousov passò quasi inos- 
servala poiché era stata pubblicata in una 
raccolta sovietica poco nota di estratti 
tecnici sul ruolo delle radiazioni in medi- 
cina. La reazione oscillante di Belousov 
presentava importanti vantaggi rispetto al 
primitivo sistema di Bray , Essa avveniva a 
temperatura ambiente e non generava 
prodotti nocivi. Inoltre, le oscillazioni 
erano chiaramente visibili quando il cerio 
passava continuamente da uno stato ossi- 
dato feerico), di colore giallo, a uno stato 
meno ossidato (ceroso), che è incolore. 

Pochi anni dopo la sua puhblicazione, la 
reazione di Belousov attirò l'atten- 
zione di A. M. Zhabotinsky dell'Istituto 
di fisica biologica nei pressi dì Mosca. Egli 
apportò modifiche ai reagenti di Belou- 
sov (sostituendo, ad esempio, il sale di 
cerio con un sale di ferro che mostra un 
viraggio di colore dal rosso al blu, più 
evidente) e iniziò uno studio sistematico 
della reazione, che ora è comunemente 
chiamata reazione BZ (da Belousov- 



-Zhabotinsky). All'inizio degli anni ses- 
santa Zhabotinsky pubblicò un'ampia 
messe di risultati sperimentali, compren- 
denti la scoperta che, se si lascia indistur- 
bato uno strato sottile di soluzione rossa 
BZ, inizialmente uniforme, compaiono 
ben presto dei punti blu che si aggregano 
fino ad assumere una sorprendente dispo- 
sizione di strutture ad anello. 

La conoscenza della reazione BZ (e del- 
la termodinamica irreversibile di Prigogi- 
ne) si diffuse rapidamente sul finire degli 
anni sessanta e all'inizio degli anni settan- 
ta. Benché i chimici di tutto il mondo fosse- 
ro affascinati dal fenomeno BZ, la grande 
maggioranza lo considerava ancora una 
curiosità, più utile per sorprendere i parte- 
cipanti a convegni, che come oggetto di 
studi seri. In breve tempo furono sviluppa- 
te molte varianti della reazione BZ, sosti- 
tuendo uno o più componenti con specie 
chimiche molto affini per ottenere una 
reazione oscillante più lenta, più veloce, o 
diversamente colorata. Tra le varianti, 
quella che visivamente colpì di più fu un 
ibrido dei sistemi BZ e Bray, messo a pun- 



to nel 1 973 da due insegnanti di una scuola 
supcriore di San Francisco, Thomas S. 
Briggs e Warren C. Rauscher. Il loro si- 
stema, che comprende acqua ossigenata, 
iodato di potassio, acido pe retorico, acido 
malonico, solfato di manganese e amido, 
varia da incolore, al colore oro e al blu, per 
poi ricominciare da capo. 

Benché la reazione BZ e le altre da que- 
sta derivate fossero diventate ben note 
verso la fine degli anni sessanta, grazie a 
dimostrazioni effettuate in ambiente scien- 
tifico, la natura del fenomeno oscillatorio 
restava un mistero. Un chimico capisce 
una reazione solo quando può scriverne il 
meccanismo, cioè una serie di reazioni, 
chiamate stadi elementari, ciascuna delle 
quali descrive un reale incontro tra mole- 
cole. La familiare equazione «stechiome- 
trica», che i chimici sono soliti scrivere per 
descrivere una reazione, mostra solo il ri- 
sultato netto e non il meccanismo con cui 
la reazione procede effettivamente su scala 
molecolare. Ad esempio, quando l'aceti- 
lene (C2H2) si combina con l'ossigeno (O2) 
in un cannello per saldatura per formare 



AGITATORE 




ELETTRODO DI RIFERIMÉNTO 



TUBO DI TROPPO-PIENO 




Il reattore a flusso e agitazione continui ha facilitato la ricerca degli 
suturi sulle reazioni chimiche oscillanti. Tornendo le condizioni di non 
equilibrio necessarie perche abbiano luogo tali reazioni. L'illustrazio- 
ne mostra una tipica disposizione sperimentale. 1 reagenti, contenuti in 
tre recipienti, vengono pompali in modo continuo alla base del reci- 



POMPA PERISTALTICA 



piente di reazione. Nel primo sistema oscillante scoperto dagli autori, i 
materiali introdotti erano soluzioni acquose acide di un clorito, di uno 
iodato e di un arsenito. 1* variazioni periodiche di colore sono con- 
trollate mediante la fotocellula. Le oscillazioni nella concentrazione di 
ioni particolari (in questo caso ioduri) sono rilevate da un elettrodo. 



88 



anidride carbonica (CO2) e acqua (H 2 0), 
la reazione globale può essere scritta co- 
me 2 C2H2 +• 5 Oa -* 4 CCb + 2 H2O. 

E però molto improbabile che due mo- 
lecole di acetilene e cinque molecole di 
ossigeno vengano a collidere simultanea- 
mente e si scindano, dando origine a quat- 
tro molecole di anidride carbonica e a due 
di acqua. La reazione in realtà avviene 
mediante una sequenza di stadi elementa- 
ri, ciascuno dei quali comporta una colli- 
sione tra due molecole, olascissìonediuna 
molecola sìngola, spesso con formazione o 
distruzione di specie intermedie che non 
compaiono affatto nell'equazione della 
reazione netta. Chiarire un tale meccani- 
smo rappresenta una enorme sfida che ri- 
chiede ingegnosità, l'analisi di molti dati 
sperimentali e spesso un'estesa simulazio- 
ne al calcolatore. 

Agli inizi degli anni settanta, si assunse- 
ro il formidabile compito di costruire un 
meccanismo per la reazione oscillante BZ 
Richard M. Noyes dell'Università dell'O- 
regon, in collaborazione con Richard J, 
Field (che è ora all'Università del Monta- 
na), ed Endre Kòròs dell'Università Eòt- 
vòs di Budapest. Entro il 1 972 essi riusci- 
rono a ideare uno schema composto di 1 8 
stadi elementari, che comportava circa 20 
specie chimiche diverse e che sembrava in 
grado di spiegare le oscillazioni. Due anni 
dopo, una simulazione dettagliata al calco- 
latore svolta da Noyes, Field e David Edel- 
son dei Bell Laboratories confermò che 
quel meccanismo prevede le oscillazioni. 
Studi successivi hanno dimostrato che esso 
spiega bene anche lo sviluppo di strut- 
ture spaziali. Noyes ha paragonato il suo 
metodo per chiarire il meccanismo al 
«metodo di [Sherlock] Holmes: "'Quando 
le altre possibilità vengono meno, ciò che 
rimane, per quanto improbabile, deve es- 
sere la verità"». 

Con la soluzione del meccanismo BZ, le 
reazioni chimiche oscillanti divennero 
un'area importante e stimolante percolerò 
che erano interessati ai meccanismi di rea- 
zione e alla dinamica chimica. Furono 
avanzate varie ipotesi sulle condizioni ri- 
chieste perché ci sìa oscillazione in una 
reazione chimica e in alcuni ambienti nac- 
que l'ottimistica speranza che la compren- 
sione dell'oscillazione chimica potesse get- 
tare nuova luce sul comportamento perio- 
dico degli organismi viventi. Nessuno, tut- 
tavia, riuscì a definire una serie di condi- 
zioni necessarie e sufficienti per l'oscilla- 
zione chimica. Quando gli anni settanta 
giunsero al termine, il numero di reazioni 
chimiche diverse con andamento oscillante 
e allora note era terribilmente scarso; tutto 
era stato scoperto per caso; si conosceva 
una sola reazione e nessuno sapeva come 
scoprirne altre. 

Anche se i sistemi biologici sono noto- 
riamente una fonte fertile dì preparati che 
mostrano oscillazione, essi tendono a sot- 
trarsi al tipo di analisi meccanicistica che 
porta a una generalizzazione. Tali sistemi 
oscillanti possono essere ottenuti, per 
esempio, estraendo il contenuto chimico 
delle cellule dì lievito e separandolo dalle 
pareti cellulari e da altre strutture estra- 



1 
2 

3 
4 

5 

6 

7 

8 

9 

10 

11 

12 

13 

14 

15 

16 

17 

18 



2H* + Br + BrOj" ss HOBr + HBrO; 

H* + HBrOj + Br" =r 2HOBr 

HOBr + Br" + H* sa Br, + HjO 

CHj(COOH); =s (OH) ? C=CHCOOH 

Br, + <OH) 3 C=CHCOOH = H* + Br" + BrCH(COOH) s 

HBrOj + BrtV + H* s* 2BrO? + H ; 

BrOj + Ce 3 * + H* =- Ce 4 * + HBrO s 

Ce" + BrO z + H,0 3= BrOj" + 2H* + Ce ■ 

2HBrO r = HOBr + BrOj " + H* 

Ce 4 * + CHj(COOH), ^ CH(COOH)j + Ce 5 ' + H* 

CHICOOH), + BfCH(COOH) 3 + H,0 ss Br" + CHMCOOH), + HOC(COOH); + H + 

Ce** + BrCH(COOH)j + H 2 s= 8r" + HOC(COOH)j + Ce 3 - + 2H* 

2HOC(COOH], ;± HOCH(COOH) } + 0=CHCOOH + C0 2 

Ce** + HOCH(COOH);. = HOC(COOH); + Ce 3 * + H* 

Ca J * + 0=CHCOOH =; 0=CCOOH + Ce 3 * + H + 

20=CCOOH + H,0 = O=CHC00H + HCOOH + CO, 

B' 2 + HCOOH — 2Br + C0 2 + 2H* 

2CH(COOH) ; + H s = CH,(C0OH] z + HQCH(COOH) s 



La simulazione al calcolatore dell'oscillazione nella reazione di Belousov-Zhabutinsk,v comporta 
18 stadi elementari e 21 specie chimiche diverse. La reazione prende il nome da due chimici 
sovietici: B. P. Belousov, al quale si deve la sua scoperta, e A. M. Zhabotinsky, che la perfezionò. I 
materiali di partenza sono tre sostanze inorganiche, gli ioni bromato (BrOj), bromuro (Br") e 
cerosi (Ce**) olire a una sostanza organica, l'acido malonico (CH i(COOH)z). Un mezzo a base di 
acido solforico fornisce gli ioni idrogeno (H*). I prodotti della reazione sono anidride carbonica 
(COj), acido formico (HCOOH) e acido bromomalonico (BrCH(COOHh). Daio che il cerio 
oscula fra i due stati di ossidazione cerico (Ce 4 *) e ceroso (Ce ì+ ), la soluzione vira alternativa- 
mente da gialla a incolore. Le reazioni rappresentate in colore comportano solo specie inorgani- 
che e sono meglio conosciute delle reazioni in nero, le quali coinvolgono specie derivate dall'aci- 
do malonico. Questo meccanismo è sialo messo a punto all'Università dell'Oregon da Richard 
M. Noyes con il collega Richard J. Field e Endre Koròs dell'Università Eòtvós di Budapest. 




POSIZIONE 



Il sistema chimico Instabile può essere rappresentato da un'analogia meccanica. Una palla che 
rotola in una buca di potenziale con due punti minimi, A e B, può fermarsi in uno dei due. .4 e fl 
rappresentano pertanto gli stati stazionari stabili del sistema; C è uno stato stazionario instabile. Una 
palla può fermarsi in C, ma la più piccola perturbazione la farà scivolare in , 1 o in /?, (Jui la variabile è 
la posizione della palla; il vincolo esterno e rappresentato dalla forma della buca di potenziale. 



89 



ss > 


\ 


1 




Vb, 








Ir* 




\ 




Ye 2 


- 


v 




*H 


- 










1 1 


— =* 



Il ciclo di isteresi È illustrato in un sistema 
chimico bLslahile. che opera in un reattore a 
flusso e agitazione continui. Quando la con- 
centrazione X a della sostanza A' che fluisce nel 
reattore aumenta, il valore dello stato stazio- 
nario Vss della specie Y nel reattore decresce 
lentamente lungo la curva in rosso finché, al 
punto critico ,4, cade da Y ai a Vai- Se Xa vie- 
ne ulteriormente aumentala, V'ss cade an- 
cora, ma lungo la curva in blu. Se A'o diminui- 
sce, l'ss ripercorre In curva in lilu al di là del 
punto .4 finche raggiunge un secondo punto 
critico A. Qui Yss balza da r'az a ì'ri. Tra A e 
B può esistere l'uno o l'altro stato si azionario. 



" 


z 




•** 




1 
1 
1 

1 
1 




N 






- 

1 










1 




* 






, 


1 1 




i 


^> 



y * 




Ci B 



A C, 



Xc 



TEMPO 



Può verificarsi oscillazione se una adatta sostanza Z viene aggiunta a un sistema chimico Instabile 
che presenta isteresi. Se Z reagisce con la sostanza Y a bassa velocità per dare la sostanza X, la 
concentrazione effettiva di quest'ultima (Xo) viene modificata in modo che il sistema «veda» un 
valore di X più elevato di quello fornito da! recipiente (a sinistre) . L'effetto di una data quantità dì 
Z su Xo (frecce in verde) è maggiore nel tratto rosso del ciclo di isteresi (dove c'è più Y) rispetto al 
tratto blu. Immaginiamo che la reazione inizi con un flusso di X uguale a C. Ora aggiungiamo 
abbastanza Z, una quantità Z«, cosi che l'effettiva Xo sia ugnale a Ci quando il sistema è nel tratto 
rosso e a Cj quando e nel tratto blu. In assenza di Z, il fiosso Xo = C darebbe un valore di stalo 
stazionario Yo Invece, con l'aggiunta di Z« il sistema segue il trailo rosso quando il valore 
effettivo di X aumenta lentamente per effetto della reazione di Y con Z. Il sistema tenta di 
raggiungere il valore dì Cb ma nel raggiungere A cade dal tratto rosso e subisce una rapida 
transizione al tratto blu. A questo punto, il sistema «vede» un valore di Xo = Cie cosi devia verso 
sinistra lungo il tratto blu nel tentativo di adattare il nuovo effettivo valore di A'o. Prima che 
raggiunga lo scopo, a Xq = B salta di nuovo al tratto rosso e il ciclo è completo (frecce in giallo): 



nee. Il «brodo» ottenuto, quando viene 
alimentato con appropriate sostanze nutri- 
tive, mostra la sua oscillazione nella con- 
centrazione degli ioni idrogeno e della 
molecola di nicotinammideadenindinu- 
cleotide, che nella sua forma ridotta 
(NADH) trasporta elettroni nel normale 
ciclo energetico della cellula. Alla Johnson 
Research Foundation, Brìtton Chance e 
collaboratori hanno dimostrato che molti 
sistemi oscillanti biologici di questo tipo 
comportano la glicolisi. il processo me- 
diante il quale le cellule producono energia 
metabolizzando zucchero in assenza di os- 
sigeno. Poiché tali reazioni sono catalizza- 
te da molti enzimi, la loro complessità è 
davvero scoraggiante. 

Nel 1 979 due di noi (Epstein e Kustin) 
hanno deciso che era giunto il momento 
di tentare di ideare una procedura sistema- 
tica per mettere a punto un sistema chimi- 
co oscillante. Ma da dove si doveva inco- 
minciare? Siamo paniti identificando tre 
condizioni che sapevamo essere necessarie 
per l'oscillazione chimica, o che contribui- 
vano ad essa. La prima condizione è che i 
sistemi chimici possono oscillare solo se so- 
no lontani dall' equilibrio. La seconda è la 
retroazione (feedback) : pane del prodotto 
di uno stadio della sequenza di reazioni 
deve esercitare un'influenza sulla sua stes- 
sa velocità di formazione. La terza è che 
il sistema chimico deve mostrare bistabili- 
tà. Nelle stesse condizioni esterne, defini- 
te vincolanti, il sistema deve poter esiste- 



re in due differenti stati stazionari stabili. 
Il requisito che il sistema sia mantenuto 
lontano dall'equilibrio potrebbe essere 
soddisfatto facendo avvenire la reazione in 
un apparecchio ben noto agli ingegneri 
chimici: il reattore a flusso e agitazione 
continui (CSTR, continuous-flow siirred- 
-mnk reaetor). Alla metà degli anni settan- 
ta. Adolphe Pacaull e collaboratori del 
Cenlre de Recherches Paul Pascal di Bor- 
deaux hanno adattato il CSTR allo studio 
dì reazioni chimiche oscillanti. Quando, 
nel 1980, uno di noi (De Kepper) ha la- 
sciato Bordeaux per raggiungere il nostro 
gruppo alla Brandeis University, è parso 
naturale costruire un reattore di questo 
tipo. L'arrivo dall'Ungheria di Orbàn. che 
aveva lavorato a lungo su sistemi oscillanti 
a base di bromato, ha completato il nostro 
gruppo. 

Un tipo comune di retroazione incon- 
trata nei sistemi viventi è l'autoeata- 
lisi, in cui la velocità con la quale una 
sostanza è prodotta aumenta con la con- 
centrazione. If concetto si estende a popo- 
lazioni di organismi: il numero di organi- 
smi aggiunti a una popolazione in un dato 
intervallo è quasi sempre proporzionale 
al numero di individui già presenti nella 
popolazione. (Questa osservazione mette 
in rilievo l'affermazione, fatta da Thomas 
Malthus nel 1798, secondo la quale le 
popolazioni tendono a esaurire le scorte 
di cibo.) In chimica i sistemi autocatalitici 



sono rari, ma non straordinari. Già nel 
1 920 Alfred J . Lotka della J ohns Hopkins 
University dimostrò che un semplice 
schema, costituito da due reazioni autoca- 
ta lìtiche accoppiate, avrebbe dato luogo a 
oscillazione. Il meccanismo di Lotka, pur 
essendosi dimostrato che non era appli- 
cabile ad alcuna reazione chimica effetti- 
va, è servito da guida per molti chimici ed 
è stato di considerevole utilità nel descri- 
vere le oscillazioni di popolazioni di pre- 
datori e di prede nei sistemi ecologici. 

Consideriamo ora il ruolo della bistabi- 
lità, ossia l'esistenza di due differenti stati 
stazionari stabili in un sistema chimico 
oscillante. Per stato stazionario si intende 
una condizione del sistema in cui tutte le 
variabili, come la concentrazione di cia- 
scuna specie chimica, hanno raggiunto 
valori costanti. Lo stato stazionario è sta- 
bile se può adattarsi a piccoli cambiamen- 
ti di una variabile, come l'aggiunta di una 
goccia di acido, rimanendo tale senza es- 
sere trasformato in un nuovo stato. Se la 
più piccola variazione provoca una transi- 
zione a un differente stato del sistema, si 
dice che lo stato originario è instabile. Per 
esempio, una piccola palla sul fondo di un 
recipiente si trova in uno stato stabile. 
Una palla in equilibrio sul bordo del reci- 
piente è in uno stato instabile. In un reat- 
tore a flusso e agitazione continui le con- 
dizioni vincolanti esterne che controllano 
i valori delio stato stazionario sono gene- 
ralmente la temperatura del bagno ter- 



90 



Zq a 



Stato stazionario 




ora A'o ha nuovamente il valore effettivo Ci, 
così che il sistema si muove ancora verso de- 
stra. La ripetizione di questa sequenza dà ori- 
gine a un'oscillazione periodica nel valore di Y 
(al centro). Il diagramma a più fasi (a destra) 
mostra come l'innalzamenlo di Z« può spo- 
stare il sistema dalla bi stabilità all'oscillazione. 
Se Z è uguale a 0, il sistema mostra due condi- 
zioni di stato stazionario: lo stato «rosso» per 
un basso valore di \ „ e lo stato «blu» per un 
valore elevato di A'o . Quando A'o viene a cade- 
re Ira A zB, il sistema è Instabile. Con l'aumen- 
tare di /». la regione di Instabilità si stringe 
finché a un valore critico inizia l'oscillazione. 



mostatico, le concentrazioni dei reagenti 
chimici nel serbatoio di alimentazione del 
reattore e le loro velocità di flusso. 

Se vengono cambiate le condizioni vin- 
colanti esterne in un sistema chimico bi- 
stabile, può verificarsi un fenomeno più 
particolare, noto come isteresi. Questo 
fenomeno è comune nel magnetismo, 
dove assume la forma di un «ciclo di iste- 
resi». Quando un pezzo di ferro è sotto- 
posto a un aumento di forza magnetica, 
esso raggiunge alla fine la completa satu- 
razione magnetica. Se la forza magnetica 
si riduce poi a zero, il ferro conserva parte 
della sua magnetizzazione. Al fine di ri- 
durre anche questa a zero, il campione di 
ferro va sottoposto a una forza magneti- 
ca in senso opposto. Il ciclo completo 
di magnetizzazione e smagnetizzazione 
prende l'aspetto di una S, spessa al centro 
e appuntita alle estremità. 

Un fenomeno analogo può verificarsi 
in un sistema chimico bistabile. Nel 1979 
un calcolo effettuato da Jacques Boisso- 
nade e da uno di noi (De Kepper) al Cen- 
tre de Recherches Paul Pascal suggerì che 
le oscillazioni potrebbero essere indotte 
aggiungendo un altro composto chimico a 
un sistema capace di isteresi. II compor- 
tamento di un sistema di questo tipo può 
essere rappresentato in un diagramma a 
più fasi, il quale mostra che. se la sostanza 
aggiunta esercita effetti diversi sui due 
rami degli stati stabili del sistema, è pro- 
babile che si sviluppino oscillazioni. 



LA SCIENZA 
DEI CALCOLATORI 

Sul continuo progredire della microelettronica 

e sulle prestazioni sempre più sofisticate 

e complesse dei calcolatori 

LE SCIENZE 

edizione italiana di SCIENTIFXC AMERICAN 

ha pubblicato numerosi articoli tra cui: 



di J 



MONTAGGIO GUIDATO 
DAL CALCOLATORE 

L. Nevins e D. E. Whitney (n. 1 Iti) 



Nella produzione in grande serie il mon- 
taggio viene eseguito a mano o con mac- 
chine specializzate, mentre automatismi 
programmabili possono essere economi- 
camente cnnvenienti per il montaggio in 
piccola serie. 



LINGUAGGI DI PROGRAMMAZIONE 
di A. I-'eldman (n. 138) 

I linguaggi di programmazione ad alto livel- 
lo hanno trasformato la elaborazione delle 
informazioni, fornendo meccanismi per 
codificare problemi complessi in modo da 
renderli risolubili con il calcolatore. 



IL CALCOLATORE 
A SUPERCONDUZIONE 

di J. Malisoo (n. 143) 

Una nuova tecnologia microelettronica 
consentirebbe di sostituire supercondut- 
tori ai transistori. Con tali componenti i 
calcolatori potrebbero eseguire un miliar- 
do di operazioni elementari al secondo. 



BACKGAMMON AL CALCOLATORE 

di H. Berliner (n. 144) 

Il backgammon costituisce un buon banco 
di prova per lo sviluppo della intelligenza 
artificiale. BKG 9.8 è il primo programma di 
calcolo che abbia battuto un campione 
mondiate in un gioco di carte o da tavolo. 



LA TECNOLOGIA 
DELLE MEMORIE A DISCO 

di R. M, White (n. 146) 

Sulla superficie di un disco rotante si pos- 
sono immagazzinare dati per un calcolato- 
re, in forma di piccole a reo! e magnetizzate. 
In dispositivi in corso di sviluppo i dati ver- 
ranno «scritti» e «lettili da un laser. 



ELABORAZIONE DI IMMAGINI 
CON IL CALCOLATORE 

di T. M Cannon e B. R. Hunt (n. 160) 

Quando le informazioni contenute in 
un'immagine sono espresse in forma digi- 
tale, possono essere elaborate meglio 
matematicamente che non per via ottica. 
Con questo sistema è possibile rendere 
nitida una fotografia sfocata. 



ALGEBRA AL CALCOLATORE 

di R. Favelle. M. Rothstcin e J. Pitch 
(n. 162) 

Un calcolatore può manipolare non soltan- 
to numeri, ma anche simboli. Nuovi algo- 
ritmi di uso generale possono svolgere 
molti compiti matematici ripetitivi oppure 
risolvere problemi altrimenti intrattabili. 



SUPÉRCALCOLATORI 

di R. D. Levine (n. 163) 

Il Crav-1 e il CYBER 205 possono esegui- 
re 100 milioni di operazioni aritmetiche al 
secondo: questa incredibile velocità è 
necessaria per risolvere problemi com- 
plessi come per esempio quelli della di- 
namica dei Fluidi. 



INTELLIGENZA ARTIFICIALE 
diD. L. Waltz(n. 172) 

Alcuni programmi di calcolatore possono 
giocare, elaborare informazioni visive, 
imparare dall'esperienza e capire fram- 
menti di linguaggio, ma non sono in grado 
di simulare il buon senso. 



PERSONAL COMPUTER 

di A. Gupta e H. D. Toong (n. 174) 

Passando in rassegna hardware, softwa- 
re, applicazioni e diffusione di questi calco- 
latori, ci si rende conto Che essi sono ac- 
cessibili anche a persone non dotate di una 
preparazione tecnica specifica. 



J 



91 



I! nostro piano per ideare un sistema 
chimico oscillante comprendeva i quattro 
stadi seguenti. Trovare un sistema auto- 
catalitico, far avvenire la reazione in un 
reattore a flusso continuo, variare le con- 
dizioni fino a trovare una regione di In- 
stabilità e, quindi, introdurre un'altra so- 
stanza capace di influire in modo diverso 
sui due rami di Instabilità e pertanto di 
indurre oscillazioni. La nostra ricerca sul- 
la letteratura chimica per le reazioni au- 
tocatalitiche ci condusse alla scoperta di 
molte reazioni interessanti. Due ci sem- 
brarono particolarmente attraenti poiché 
avevano come intermedio comune lo io- 
dio. Una reazione coinvolgeva gli ioni 
iodato e l'arsenito, la seconda gli ioni io- 
duro e il clorito. Come si potrà immagina- 
re, una reazione poteva avere un'auspi- 
cabile influenza perturbante sull'altra. La 
reazione con iodato e arsenito si rivelò 



ben presto bistabile. Quando venne in- 
trodotto il clorito, il sistema composito 
iniziò quasi immediatamente a oscillare. 
Il primo sforzo sistematico per ideare un 
nuovo sistema chimico oscillante fu, 
quindi, coronato da successo. 

Variando i componenti che entrano nel 
reattore a flusso continuo, noi ab- 
biamo da tempo esteso il sistema oscillan- 
te iniziale clorito -iodato- arsenito a un 
gruppo di due dozzine di sistemi oscillanti 
correlati, che hanno tutti in comune lo 
ione clorito. Possiamo tracciare una clas- 
sificazione dei sistemi oscillanti a base di 
clorito e stiamo cominciando a vedere in 
che modo possono essere messi in rela- 
zione con i sistemi oscillanti delle famiglie 
del bromato e dello iodato. 

Benché i sistemi bromato siano stali fra 
i primi a essere scoperti e il loro meccani- 



smo sia meglio conosciuto di quello dei 
sistemi clorito, la varietà dei sistemi clori- 
to, che abbiamo trovato deliberatamente, 
è di gran lunga più ampia. Due fattori, 
uno chimico e l'altro storico, spiegano 
questo apparente paradosso. Dal punto di 
vista chimico, ogni famiglia di sistemi 
chimici oscillanti ha un membro minimo 
(più semplice) dal quale gli altri possono 
essere derivati per aggiunta di altre so- 
stanze. Il più semplice sistema oscillante a 
base di clorito, clorito più ioduro, oscilla 
entro un'ampia gamma di condizioni. Al 
contrario, il più semplice sistema oscillan- 
te a base di bromato, bromato più bromu- 
ro più uno ione metallico, funziona solo 
entro limiti ben precisi. Infatti, anche 
dopo che l'esistenza del sistema oscillante 
più semplice a base di bromato era stata 
prevista da un ricercatore. Kedma Bar- 
-EU dell'Università di Tel Aviv, la sua 



SISTEMI BROMATO 
CONTENENTI IONI METALLICI ESENTI OAJONI METALLICI 



SISTEMI CLORITO 



ESENTI DA IODIO 



BROMATO 

+ 
BROMURO 

IONE 

METALLICO 

(SISTEMA 

MINIMO) 



BROMATO 

+ 
BROMURO 

+ 
RIDUCENTE 



CLORITO 

+ 
BROMURO 

+ 
OSSIDANTE 



CONTENENTI IODIO 



CLORITO 

+ 

RIOUCENTE 



CLORITO 
+ 

IODURO 
(SISTEMA 

MINIMO) 




BROMATO 

+ 
BROMURO 

-+- 

IONE 

METALLICO 

OSSIDANTE 



BROMATO 

+ 
BROMURO 

IONE 
METALLICO 

+ 
RIDUCENTE 






RIOUCENTE 
ORGANICO 



RIDUCENTE 
INORGANICO 



CLORITO 

+ 

IODATO 

+ 

RIDUCENTE 



CLORITO 

+ 

IODIO 

+ 

RIDUCENTE 



XI 




CLORITO 

+ 

IODURO 

+ 

OSSIDANTE 



SISTEMI IODATO 



RIDUCENTE 
INORGANICO 



HIDUCENTE 
ORGANICO 






IODATO 

+ 

ACQUA OSSIGENATA 



RIDUCENTE 
INORGANICO 



RIDUCENTE 
ORGANICO 



IODATO 

+ 

ACQUA OSSIGENATA 

+ 

CATALIZZATORE 

+ 

RIDUCENTE 



1 principali tipi dì sistemi chimici oscillanti sono raggruppati, in un 
tentativo di classificazione, in Ire famìglie principali. Il sistema origina- 
rio di Belousov-Zhabotinsky e tutte te sue numerose varianti si trovano 
nel ramo della famiglia del bromalo che ha ioni metallici. La sistema- 
rione del sistema bromato net ramo esente da ioni metallici e opera di 
hi.ru* e di uno degli autori (Qrbàn). Tutti ì sistemi oscillanti a base di 
clorito sono stati scoperti dagli au lori alla Brandeis University. I sistemi 
al bromato che comportano riducenti inorganici sono stati messi a 



punlo nella stessa sede in condizioni di flusso continuo. La famiglia 
dello iodato ha il minor numero di membri. Il primo sistema elencato in 
essa È la reazione oscillante illustrata nel 192! da William C. Bray 
dell'Università della California a Berkeley e ignorata per 50 anni. Il 
secondo sistema nella famiglia dello iodato è un ibrido tra i sistemi 
Belousov-Zhabotinsky e Bray. Linee tratteggiate coilegano i sistemi 
che hanno alcuni reagenti in comune. Un riducente è una sostanza 
che cede elettroni a un'altra; ossidante è una sostanza che li acquista. 



ricerca non diede frutti finché due di noi 
(Orbàn ed Epstein) riuscirono a trovarlo 
seguendo il nostro metodo sistematico 
basato sul diagramma a più fasi. 

Dal punto dì vista storico, il primo si- 
stema oscillante a base di bromato fu sco- 
perto prima che entrassero in funzione i 
reattori a flusso continuo. Sistemi del 
genere oscillavano facilmente in condi- 
zioni di flusso zero, l sistemi a base di 
clorito, come la grande maggioranza dei 
nuovi sistemi, mostrano un comporta- 
mento periodico solo in condizioni di flus- 
so continuo, poiché il flusso è necessario a 
mantenerli lontani dall'equilibrio. Un si- 
stema che oscilla in condizioni di flusso 
zero quasi sempre oscillerà anche in con- 
dizioni di flusso, ma raramente avviene il 
contrario. La maggior parte dei sistemi 
bromato fu originariamente ricercata in 
condizioni di flusso zero, mentre quelli clo- 
rito furono in origine ricercati solo in condi- 
zioni di flusso. Di conseguenza, la varietà 
di sistemi a base di clorito, che sono stati 
scoperti, ha presto superato la varietà dei 
sistemi a base di bromato. (Trovammo 
successivamente, però, che molti sistemi 
oscillanti a base di clorito operano an- 
ch'essi in condizioni di flusso zero.) Si può 
dire che l'estrema facilità di oscillazione 
dei primi sistemi a base di bromato ritar- 
dò la ricerca di altri sistemi. Soltanto re- 
centemente i reattori a flusso continuo 
sono stati impiegati in modo intensivo 
nella ricerca dì nuovi sistemi oscillanti a 
base di bromato e allo studio di una terza 
famiglia, finora la più piccola: ì sistemi a 
base di iodato. 

Uno degli scopi della progettazione di 
un nuovo sistema chimico oscillante fu 
quello di poter disporre di un sistema il 
cui meccanismo potesse essere decifrato e 
confrontato con quello delle reazioni 
oscillanti precedentemente esaminate. 
L'analisi della famiglia dei sistemi oscil- 
lanti a base di clorito è ora ben avviata. 
Abbiamo completato gli studi delle velo- 
cità dì numerosi processi componenti e 
pertanto abbiamo numerose tessere del 
mosaico; per avere una descrizione com- 
pleta dello schema oscillante basta ora 
spostare gruppi di tessere finché comba- 
cino tutte insieme nel modo giusto. 

Siamo già in grado di dare un quadro 
schematico del modo in cui funziona il 
nostro primo sistema oscillante, quello 
costituito da soluzioni di sali di potassio o 
di sodio sotto forma di clorito, iodato e 
arsenito. Il sistema comporta solo quattro 
reazioni principali, ciascuna delle quali 
composta di numerosi stadi elementari. 
Due di essi comportano la reazione del 
clorito con lo ioduro o con lo iodio per 
dare nel primo caso cloruro e iodio e nel 
secondo cloruro e iodato. Nel terzo stadio 
lo iodato e lo ioduro reagiscono per for- 
mare iodio. Nel quarto lo iodio e l'arseni- 
to formano ioduro e arseniato. Variazioni 
nelle velocità di queste quattro reazioni 
danno luogo a oscillazioni periodiche nel- 
le concentrazioni di iodio e iodato e nel 
rapporto tra arseniato e arsenito (si veda 
l'illustrazione in alto}. 

L'oscillazione chimica, benché af fasci- 



/■. 


IODIO 1 1 1 

1 II 


Ili 


1 III 

A A Ai 


7- 


/ 1 / 1 /li i ì 


q 


/ 1 / / il i 


N 




< 




Ci 


/ / /M 1 


F 


/ l / l i / 1 1 1 


z 


/ V / U /li 


m 


/ \ / ^ / ' \ \ 


o 


/ \ / \ / i\ 


/ 


/ V / \ i / \ ■ i 


i) 




U 


> — * \Ss i vL/ 

i 1 i i 



2 ARSENIATO'ARSENITO 
O 




ui 

z 
o 

N 
< 
OC 

F 
Z 

ìli 



8 



IODURO 


/O 




! 1 1 






J 


1 
\ 1 

f 1 

V 1 1 


/ 

fi 





s e 



TEMPO 



1 CLORFTO+ IODURO — CLORURO + IODIO 

2 CLORITO + IODIO -> CLORURO + IODATO 



3 IODATO + IODURO -» IODIO 

4 IODIO + ARSENITO - IODURO + ARSENIATO 



L'andamento delle oscillazioni nel primo sistema oscillante messo a punto dagli autori può 
essere compreso qualitativamente considerando l'interazione tra quattro reazioni principali. Il 
sistema è alimentato con un flusso uniforme e bilanciato di tre soluzioni saline: una di clorito, la 
seconda di arsenito e l'ultima di iodato. All'interno del reattore a flusso continuo le concentra- 
zioni dello iodio e dello iodato e il rapporto arseniato/arsenito oscillano, come appare dalle tre 
curve. Al punto A le concentrazioni di ioduro e di arsenito sono elevate, mentre quelle dello 
iodio e dell'arsemi) lo sono basse, così che le reazioni predominanti sono la / e la 3, Per effetto di 
queste reazioni aumenta bruscamente la concentrazione dello iodio, mentre incomincia a dimi- 
nuire la concentrazione dello ioduro; il sistema raggiunge il punto fi e si interrompono le 
reazioni / e J. Si svolgono allora le reazioni 2 e 4, con l'esaurimento dello iodio e la conversione 
dell'arsemi» in arseniato. II sistema raggiunge il punlo C, dove l'arsenito e lo ioduro si trovano ai 
loro livelli minimi, o quasi. L'arsenito viene reimmesso nel reattore e t'arseniato viene scari- 
calo. La reazione 4 rigenera ioduro, mentre consuma iodio e pertanto il sistema ritorna in A. 



nante di per se stessa, è connessa a nume- 
rosi altri fenomeni di almeno pari interes- 
se. Uno 6 la formazione di strutture spa- 
ziali in un mezzo inizialmente omogeneo. 
Tali strutture si sviluppano, per esempio, 
in uno dei sistemi oscillanti che abbiamo 
scoperto, dove i reagenti sono clorito, 
ioduro e acido malonico. Quando è pre- 
sente l'amido come indicatore, la soluzio- 
ne ha inizialmente un colore uniforme 
rosso violaceo, a causa di un complesso 
costituito da ioduro, iodio e amido. Con il 
procedere della reazione appaiono punti 
bianchi, che si ingrossano fino a formare 



anelli e serie di anelli concentrici che si 
annientano quando urtano fra di loro. Un 
osservatore ha paragonato la comparsa 
dei punti bianchi nel color rosso circo- 
stante alla apparizione improvvisa di stel- 
le. La comparsa di tali forme geometriche 
in una massa che prima era indifferenzia- 
ta fa venire subito alla mente il genere di 
processi che permette alle cellule em- 
brionali negli organismi animali di unirsi 
in tipi individuali destinati a diventare 
sangue, cervello o osso. 

Un altro fenomeno affine, che ha fatto 
sorgere una grande controversia fra i 



92 



93 





r\ 




f~N 



r f 



r\ 




30 MINUTI 
«E > 



30 MINUTI 



Le oscilla/irmi periodiche nella reazione clorito-litisolfato mostrami una varietà di modelli quan- 
do viene alterata la velocità di immissione in un reattore a Flusso continuo. Ogni ciclo ha una 
oscillazione ampia e n oscillazioni piccole, dove n varia da Da (6. Ciò si verifica per tutti i cidi. 




* Il 




mw 



w 



30 MINUTI 



Un'oscillazione aperiodica, o caotica, si osserva talvolta in una stretta gamma di velocita di flusso. 
Ira velocità che danno un comportamento periodico complesso. Una forma di caos consiste in un 
miscuglio casuale di due tipi di oscillazioni periodiche, una con n e l'altra con n - l piccole 
oscillazioni per nani ampia oscillazione. Una possìbile spiegazione è che le variazioni incontrollate 
nella velocità di flusso facciano oscillare a caso il sistema da una velocità che dà oscillazione di tipo 
a a un'altra che dà oscillazione di tipon • 1. L'alternativa, favorita dagli autori, è che l'oscillazione 
caotica sia intrinseca nella dinamica della reazione chimica a determinate velocità di flusso. 



chimici, maggiore di quella sorta un quar- 
to di secolo fa quando fu messa in dubbio 
la realtà delle reazioni oscillanti, è il «caos 
chimico». Il termine si riferisce al com- 
portamento di una reazione in cui le con- 
centrazioni non raggiungono valori co- 
stanti e neppure oscillano periodicamen- 
te, ma piuttosto aumentano e diminui- 
scono in un modo apparentemente casua- 
le e imprevedibile. Noi abbiamo notato 
tali fluttuazioni nel sistema BZ e in uno 
dei nostri nuovi sistemi oscillanti a base di 
clorito, quando vengono fatti reagire in 
un reattore a flusso continuo sotto accura- 
to controllo. Essi sono di particolare inte- 
resse per i matematici poiché se fossero 
per natura inerenti alla dinamica della 
reazione, essi rappresenterebbero esempi 
fisici di quegli oggetti matematici noti 
come «attrattori strani». Brevemente e in 
qualche modo grossolanamente, gli attrat- 
tori strani possono comparire quando al- 
cune equazioni sono iterate, o risolte ripe- 
tutamente, con il risultalo che una itera- 
zione serve da entrata per la successiva. In 
un sistema di equazioni con un attrattore 
strano il percorso segnato da soluzioni 
successive sembra variare in modo im- 
prevedibile da mi ciclo all'altro. 

Chimici scettici hanno ipotizzato che il 
caos chimico non rappresenti niente di 
più che fluttuazioni sperimentali incon- 
trollate, per esempio nella temperatura o 
nella velocità di flusso, che spingono a 
caso un sistema da un modo di oscillazio- 
ne periodica complessa a un altro. Sebbe- 
ne un giudizio definitivo non sia stato 
ancora dato, un recente e accurato lavoro 
sperimentale e teorico di Harry L. Swin- 
ney e Jack Turner dell'Università del 
Texas a Austin, di Jean Claude Roux. 
Christian Vida! e collaboratori del Centre 
de Recherehes Paul Pascal e di J. L. Hud- 
son dell'Università della Virginia propo- 
ne che il caos chimico sia un fenomeno 
genuino inerente alla dinamica di alcuni 
sistemi chimici oscillanti. Le implicazioni 
di questo caos intrinseco non sono ancora 
conosciute. Potrebbe darsi, come Henry 
Adams osservò una volta, che «il caos 
spesso genera la vita, quando l'ordine 
genera abitudine»? 

Ora che i sistemi chimici oscillanti han- 
no dimostrato non solo di essere 
compatibili con le leggi della natura, ma 
anche di poter essere ideati e descritti 
sistematicamente, incominciano ad avere 
un ruolo sempre più importante in molti 
settori scientifici. Il passaggio da uno sta- 
to a un altro, che caratterizza una reazio- 
ne oscillante, può serbare la chiave per 
capire i processi di regolazione nelle cellu- 
le viventi, come i meccanismi che inne- 
scano o arrestano la copiatura di un fila- 
mento di DNA o la contrazione di un 
muscolo. Le slesse forze che creano anelli 
e strati colorati in sistemi chimici oscillan- 
ti non sottoposti a rimescolamento pos- 
sono anche essere responsabili della sepa- 
razione degli anelli di Saturno e delle 
striature periodiche in alcune formazioni 
rocciose, spiegate con difficoltà dai pro- 
cessi geologici convenzionali. 

Sembra inoltre plausibile che molte e 



94 



AMBIENTE 

E 

INQUINAMENTO 



I^K S(,lK!\Ar, edizione italiana di 

SCIKMMIC AMERICAN 

ha pubblicato su questo argo- 
mento numerosi articoli tra cui: 



CIRCOLAZIONE GLOBALE 

DELL'INQUINAMENTO 

ATMOSFERICO 

di R. E.Newell <n. 32) 



INQUINAMENTO DA MERCURIO 
di L. J. Goldwater (n. 36) 



ENERGIA «PULITA» 
DA COMBUSTIBILI «SPORCHI» 

di A. M. Squires (n. 53) 



L'ELIMINAZIONE 
DEI RIFIUTI NELL'OCEANO 

di W. Bascom (n. 76) 



FARFALLE MELANICHE 
E ARIA PULITA 

di J. A. Bishop e L. M. Cook (n, 81) 



CATRAME PELAGICO 

di J. N. Butter (n. 86) 



L'INQUINAMENTO DA TRIZIO 

di G. Zampa ro (n. 90) 



EFFETTI ANTROPOGENICI 
SULL'OZONOSFERA 

dì F. Vemiani (n. 102) 



IL CONFINAMENTO 
DELLE SCORIE RADIOATTIVE 

di B. L. Cohen (n. 110) 



IL PROBLEMA 
DELL'ANIDRIDE CARBONICA 

di G. M. Woodwell (n. 115) 



INQUINAMENTO DA PCB 

di H. Suzuki (n. 116) 






In un sistema chimico oscillante a base di clorito, ioduro e acido ma lo ni co. scoperto dagli auto- 
ri, si sviluppa una struttura spaziale. La soluzione, posta in una piastra di vetro poco profonda, è 
inizialmente di un colore rosso bru nastro uniforme per la formazione di un complesso tra iodio, 
ioduro e amido, usato come indicatore. AI procedere della reazione appaiono punti bianchi, 
che si ingrossano fino a Tonnare anelli e serie di anelli concentrici, che si annullano quando 
si urlano. L'ultima fotografia È stala scattala circa 90 secondi dupo l'inizio della reazione. 



forse tutte le reazioni catalitiche che 
sono fondamentali per l'industria chimi- 
ca procedano in modo oscillante. 11 ca- 
talizzatore può alternarsi tra due forme 
in un intervallo di tempo troppo breve 
perché sia rilevato dai normali processi 
di analisi. Lo studio di reazioni oscillanti 
può fornire un terreno di prova per teo- 
rie sulla catalisi e, più in generale, sulla 
dinamica delle reazioni chimiche. Qua- 
lunque modello possa prevedere con 



successo il complesso comportamento di 
sistemi oscillanti dovrebbe essere in gra- 
do di trattare senza difficoltà i fenomeni 
più semplici osservati in reazioni meno 
strane. Aumentando il numero dei si- 
stemi chimici oscillanti trovati o ideati 
deliberatamente, si può sperare di trova- 
re la chiave per penetrare in una varietà 
di fenomeni, compresi quegli «orologi» e 
«caroselli» che operano all'interno del 
nostro corpo. 



98 



Il DNA mitocondriale 

// mitocondrio, un organetto generatore di energia, possiede un proprio 
sistema genetico. L'organizzazione dei suoi geni e la versione del codice 
genetico «universale» che esso dà sono diverse da quelle di nucleo e batteri 

di Leslie A. G rive li 



Un miliardo e mezzo o due miliardi 
di anni fa. quando sulta Terra 
c'era ancora poco ossigeno, un 
batterio primitivo che viveva in condizio- 
ni precarie, traendo energìa dalla fermen- 
tazione anaerobica di molecole organi- 
che, inglobò una cellula più piccola che 
aveva sviluppato in un certo modo la ca- 
pacità di respirare. Questo evento costituì 
una svolta importante nella evoluzione 
organica. La respirazione libera molta più 
energia della fermentazione e la crescente 
abbondanza di ossigeno nell'atmosfera 
deve essere stata la forza trainante di que- 
sta relazione simbiotica, sviluppatasi tra 
le cellule, con la cellula aerobica che ge- 
nerava energia in cambio di protezione e 
nutrimento, offerti dall'ospite di dimen- 
sioni maggiori. 

Col tempo, la cellula inglobata e altre 
come essa sarebbero divenute organelli 
subcellulari, trasmessi dalle cellule ospiti 
alla loro progenie. Alla fine, anche le cel- 
lule ospiti si sarebbero modificate, svi- 
luppando altre strutture subcellulari e 
membrane interne e segregando il pro- 
prio materiale genetico in cromosomi al- 
l'interno dì un nucleo. Queste cellule fu- 
rono le antenate di tutte le attuali cellule 
eucariote (nucleate): protozoi, alghe e le 
singole cellule dei funghi, delle piante e 
degli animali. I discendenti attuali di que- 
gli antichi batteri simbionti, dotati di re- 
spirazione, sono i mitocondri, le centrali 
energetiche della cellula eucariota. 

I mitocondri sono organelli ovali o 
vermiformi, con diametro di circa mezzo 
micrometro e lunghezza da due a cinque 
micrometri. Questa è più o meno la di- 
mensione di molti batteri attuali. Il mito- 
condrio possiede una membrana esterna 
e una intema, che presenta ampie ripiega- 
ture e racchiude una matrice liquida. Esso 
è la sede delta fosforìlazione ossìdatìva, la 
fonte primaria di energia cellulare. Nella 
matrice liquida, le molecole organiche 
derivate dalla degradazione degli alimen- 
ti vengono ossidate in una serie di reazio- 
ni chimiche, note come ciclo dell'acido 
citrico. Gli elettroni rimossi nel corso del- 
l'ossidazione vengono trasportati lungo 
una catena di complessi enzimatici respi- 



ratori, allineati sulla membrana interna, 
i quali guidano la fosforìlazione del- 
l' ad enosindifosfat o in adenosintrifosfato 
(ATP), la moneta di scambio energetico 
universale delle cellule. Il citoplasma del- 
le cellule eucariote (cioè la regione della 
cellula esterna al nucleo) contiene da 
pochi a molte centinaia di mitocondri: 
quanto maggiore è il fabbisogno energeti- 
co della cellula, tanto maggiore è il nume- 
ro dei mitocondri. 

Forse proprio perché discendono da un 
batterio libero, i mitocondri hanno un 
materiale genetico proprio e un proprio 
meccanismo per esprimerlo. Questa pos- 
sibilità, che i mitocondri avessero i propri 
geni, distinti dal genoma contenuto nel 
nucleo cellulare, cominciò a farsi strada 
fin dal 1 949, quando Boris Ephrussì trovò 
che la capacità del lievito da panificazione 
di realizzare una fosforìlazione ossida t iva 
sembrava controllata da qualche fattore 
presente nel citoplasma e non nel nucleo. 
Solo nel 1966, tuttavia, venne isolato e 
caratterizzato il primo DNA mitocondria- 
le di vertebrato (pollo). Da quella data in 
poi, molti DNA mitocondriali di vari or- 
ganismi sono stati oggetto di uno studio 
intensivo in numerosi laboratori europei 
e statunitensi. Affascinanti interrogativi 
furono: Che cosa fa il DNA mitocondria- 
le? In che modo si organizza e si esprime? 
Perché la cellula dovrebbe mantenere un 
secondo sistema genetico oltre a quello 
contenuto nel nucleo? Cominciano a farsi 
strada oggi le risposte ai primi due quesiti 
e ciò permette perlomeno di avanzare 
ipotesi sulla terza e più ampia questione. 

Negli ultimi due anni sono stati riporta- 
ti nuovi e importanti dati, grazie soprat- 
tutto all'applicazione della genetica mo- 
lecolare e di potenti nuove tecniche alla 
rapida determinazione della sequenza dei 
nucleotidi (le unità costruttive del DNA) 
nel genoma. La completa sequenza nu- 
cleotidica del DNA mitocondriale umano 
è stata pubblicata all'inizio del 1981 daB. 
G. Barre l e collaboratori del laboratorio 
di Frederick Sanger presso il Medicai 
Research Council Laboratory of Molecu- 
lar Biology di Cambridge; contempora- 
neamente Giuseppe Attardi del Califor- 



nia Institute of Technology ha analizzato 
la trascrizione del DNA mitocondriale 
umano in RN A. Subito dopo, il gruppo di 
Barre!] ha pubblicato la sequenza del 
DNA mitocondriale di bue e David A. 
Clayton e collaboratori del California In- 
stitute of Technology quella del DNA 
mitocondriale di topo. Nel frattempo, 
anche la sequenza dì una grande parte dei 
genoma mitocondriale di lievito è stata 
dipanata da Alexander Tzagolov della 
Columbia University e dal suo gruppo. 
Quella che si sta sempre più delineando è 
la diversità, per molti aspetti fondamenta- 
li, dei vari DNA mitocondriali nei riguar- 
di di qualunque DNA noto. Le loro insoli- 
te caratteristiche potrebbero rappresen- 
tare le ultime tracce del primitivo organi- 
smo aerobico, che molto tempo fa colo- 
nizzò i batteri fermentanti, dando così ini- 
zio alla rivoluzione eucariota. 

// genoma e le sue proteine 

Il DNA mitocondriale è come quello 
dei batteri, nel senso che consiste di un'u- 
nica doppia elica di DNA nudo, mentre il 
DNA nucleare degli eucarioti forma un 
complesso ben aderente con le proteine 
ed è ripartito tra un certo numero dì cro- 
mosomi distinti. Tranne eh e in alcuni pro- 
tozoi, l'elica di DNA è conformata (di 
nuovo come nei batteri) ad anello. Nella 
maggior parte delle specie, tuttavia, il 
genoma mitocondriale è molto più picco- 
lo di quello dei batteri più semplici: come 
dimensioni, è più vicino al genoma di mol- 
ti virus. Le dimensioni variano ampia- 
mente secondo l'organismo. I mitocondri 
degli animali hanno perloppìù circa 
15 000 nucleotidi, mentre il DNA mito- 
condriale del lievito è cinque volte più 
lungo e quello delle piante ancora cinque 
volte di più. In buona parte la differenza 
di lunghezza tra DNA animale e DNA di 
lievito si può attribuire alla notevole di- 
versità con cui è organizzata la stessa serie 
fondamentale di geni. Non si è ancora in 
grado di affermare se questo valga anche 
per il DNA mitocondriale delle piante. 

Pur avendo il proprio materiale geneti- 
co, il mitocondrio non è però autosuffi- 



102 



;.T ->«•;.;■.. .-iVX»?- 




<^:?;v>. 



*&&,> 



Il DNA mitocondriale del lievito di birra, Saccharomyces carlsbrrgert' 
sis, appare ingrandito di circa 60 000 diametri in questa microfotogra- 
fia elettronica eseguita da Ernst F, J. Van Bruggen dell'Università 



•• ':'. '• .-. ^.'.-v'ì.rv- •'.•:• ■<■■'.; ■;'. . ; - .;>ài<K':--V:«'- •■'■■:': : •■■:■'" '■.". ■■'.■."■/:.>■•: »■'■, 

statali- di Croningen. in Olanda. La molecola appare come un doppio 
filamento ad anello di DNA, «avvolto a superelica», con una circonfe- 
renza di 26 micrometri. Essa è costituita da circa 75 000 nucleotidi. 



'Tv 









m 






:M 




'/?■ 



Il genoma mitocondriale del protozoo Te tra h\ mena pyrìformis si presen- 
ta conte una molecola lineare. In questa microf olografia ripresa da Annika 
C. Araberg e da Van Bruggen, esso appare ingrandito di circa 26 000 



diametri e si Irova in uno stadio precoce di duplicazione. Un centro di 
duplicazione si e costituito presso la metà della molecola e si sta estenden- 
do mentre nuovo DNA viene sinterizzato lungo entrambi i filamenti. 



103 



MEMBRANA 
INTERNA 




SPAZIO TRA LE 
MEMBRANE 



MATRICE 



DNA MITOCONDRIALE 



DNA NUCLEARE 



BLOCCO DA 
PARTE DELLE 
ACRIDINE E DEL 
BROMURO 
DI ETIDIO 



RNA MESSAGGERO 



BLOCCO DA 
PARTE DEL 
CLORAMFE- 
NICOLO, DELLA 
TETRACICLINA 
E DEI MACROUDI 



■t 



PROTEINE 




CITOCROMO b 



COMPLESSO U0ICHINOLO- 
-CITOCROMO c-RIDUTTAS! 



SPAZIO TRA LE 
MEMBRANE 

La struttura e ta funzione del mitocondrio vengono definite congiuntamente da geni presenti nel 
nucleo cellulare e da altri presenti nello stesso mitocondrio. Questo organetto, che compare in 
sezione longitudinale (a), ha una membrana esterna e una membrana interna profondamente 
ripiegata, che racchiude una matrice liquida. In tutti gli organismi esaminati finora, il DNA del 
mitocondrio codifica per gli RNA ribosomali e gli RNA di trasporto, presenti nelt'organello 
stesso, e per elementi del meccanismo prò te ino sintetico. Altri geni mitocondriali codificano perle 
proteine. Nel lievito ne sono note appena sei, specificate dal genoma mitocondriale fé), tre 
subunità dell'enzima citocromo oossidasiOn verde), due suhunila dell'enzima ATP-asifin giallo} 
e la proteina citocromo 6 (in rosso). Tutte e sei prendono parte alla fosforila* ione ossidali* a, la 
principale fonte di energia cellulare. La maggior parte delle prolcinc che costituiscono l'orfanello 
o che sono necessarie per il funzionamento del suo sistema genetico vengono codificate, invece, 
nel nucleo. Si può sapere se responsabile di una particolare sintesi è il sistema genetico nucleare 
o quello mitocondriale, bloccando chimicamente uno dei sistemi di trascrizione o di traduzione. 



dente sotto l'aspetto genetico: infatti, la 
maggior parte delle proteine che sono 
responsabili della struttura e della fun- 
zione di questo organetto sono codificate 
nel nucleo. Il DNA del mitocondrio speci- 
fica l'RN A dei suoi ribosorai (gli organelli 
su cui sono sintetizzate le proteine) e i 
suoi RNA di trasporto (che trasportano 
amminoacidi specifici sui ribosomi affin- 
ché siano riuniti e costituiscano proteine). 
Finora si è trovato che, come per le pro- 
teine, i DNA mitocondriali sintetizzano 
RNA messaggero che codifica solo per 
alcune subunità dei complessi enzimatici 
respiratori, situati nella membrana inter- 
na dell'organello. Il resto delle proteine 
della membrana in tema, cosi come quelle 
della matrice (comprendenti gli enzimi 
che intervengono nel ciclo dell'acido ci- 
trico) e della membrana estema, è tutto 
codificato dai geni nucleari, sintetizzato 



nel citoplasma dai ribosomi e quindi im- 
portato nel mitocondrio. Oltre a rifornire 
il mitocondrio della maggior parte dei 
suoi materiali strutturali, il nucleo codifi- 
ca per tutti gli enzimi necessari alla repli- 
cazione del DNA mitocondriale e alla sua 
trascrizione in RNA; inoltre, il nucleo 
codifica per le proteine che si combinano 
con l'RN A per formare ì ribosomi, e spe- 
cifica altri fattori necessari alla sintesi del- 
le proteine mitocondriali. In altre parole, 
il sistema genetico mitocondriale sì con- 
serva solamente grazie a un considerevole 
investimento da parte del nucleo e del 
meccanismo cellulare per la sintesi delle 
proteine. 

Nella cellula vivente i contributi dispa- 
rati dei due sistemi genetici sono coordi- 
nati, ma vi è una certa libertà d'azione in 
questo accoppiamento: la cellula può vi- 
vere per un certo tempo mentre l'attività 



genetica, o del nucleo o dei mitocondri, è 
bloccata. Per esempio, la sintesi proteica 
dei mitocondri è bloccata da antibiotici 
antibatterici come il cloramfenicolo. la 
tetraciclina e il gruppo dei macrolidi ; non 
viene, invece, alterata dalla cicloesùnmi- 
de, che inibisce l'attività dei ribosomi ci- 
toplasmatici. Si possono sistemare le cose 
in modo che, mentre un sistema è blocca- 
to, le proteine sintetizzate siano marcate 
con un isotopo radioattivo, determinando 
cosi ciò che ogni sistema esattamente 
produce. 

Questi esperimenti di marcatura hanno 
identificato i prodotti del DNA mitocon- 
driale in un certo numero di organismi. 
Identificare i geni che codificano per tali 
prodotti e individuarne la posizione sul- 
l'anello di DNA è stato, però, un compito 
arduo, perlomeno fino a quando non sono 
stati messi a punto i nuovi metodi per 
ricostruire la sequenza del DNA. L'iden- 
tificazione dei geni e la costruzione delle 
loro mappe mediante analisi genetica 
dipendono dalla possibilità di annotare e 
seguire le mutazioni che interferiscono 
con l'attività di un gene senza uccidere 
l'organismo. In assenza di ossigeno, un 
lievito può cavarsela con la sola fermen- 
tazione e riesce così a sopravvivere senza 
mitocondri funzionanti. E stato cosi pos- 
sibile annotare e caratterizzare in esso 
mutazioni che sono letali in altri organi- 
smi; come risultato, il DNA mitocondria- 
le del lievito è stato il primo a essere stu- 
diato in modo approfondito. 

L'analisi genetica combinata con la 
tecnica di ricostruzione delle sequenze 
del DNA ha ormai fornito inventari di 
geni sia per i genomi mitocondriali umani 
sia per quelli di lievito, assieme a mappe 
particolareggiate della loro disposizione. 
I mitocondri del lievito e quelli umani 
hanno essenzialmente gli stessi geni, ma 
l'organizzazione di questi ultimi è sor- 
prendentemente diversa. 

L'organizzazione del genoma 

Ogni nucleotìde del DNA è caratteriz- 
zato da una o l'altra di quattro basi e la 
sequenza nucleotidica dei due filamenti 
della doppia elica è complementare: l'a- 
denina (A) su un filamento si appaia con 
la timina (T) sull'altro filamento, mentre 
la guanina (G) si appaia con la citosina 
(C). Le triplette di basì su un filamento (il 
filamento codificante) servono da parole 
di codice (codoni), le quali, trascritte 
nel l'RN A, specificano o un particolare 
amminoacido o un segnale per dare inizio 
terminare la traduzione. Nel DNA che 
costituisce i cromosomi degli eucarioti, i 
codoni sono perloppiù una minoranza: le 
file dì triplette che costituiscono un gene 
sono affiancate da spaziatori lunghi e non 
codificanti e da regioni che fungono da 
segnalazione, entrambi non trascritti in 
RNA, inoltre da altri segmenti che sono 
trascritti in RNA messaggero, ma non 
sono tradotti. Gli stessi geni sono spesso 
suddivisi in segmenti separati da sequen- 
ze intercalari non codificanti, chiamate 
«introni». 

Il DNA mitocondriale umano, per con- 



104 



irò. è un modello di economia. Ha solo 
16 569 coppie di basi e sembra che 
praticamente ognuna di esse sia stata 
messa in servizio, con l'uno o l'altro fila- 
mento che serve di volta in volta da fila- 
mento codificante. In effetti, i geni sono 
così ravvicinati tra loro che possono es- 
servi nel mezzo, se pure ve ne sono, solo 
pochi nucleolidi non codificanti. Vi sono 
geni per due RNA ribosomali. per 22 
RNA di trasporto e per cinque proteine 
della membrana; si possono annoverare. 



inoltre, otto moduli di lettura senza asse- 
gnazione (MLSA). (Si tratta di regioni 
in cui triplette dì nucieotidi in successione 
possono essere lette con codoni che spe- 
cificano amminoacidi e in cui la sequen- 
za di tali triplette non viene interrotta 
da codoni che indicano la fine. Queste 
regioni devono specificare una proteina, 
ma questo prodotto proteico non è stato 
ancora identificato.) Nessuno di questi 
geni contiene introni. Pochissimo DNA 
codifica per l'RNA messaggero, che in 



seguito non viene tradotto in proteina. 
Sia nei genomi batterici sia nei genomi 
eucarioti non mitocondriali, la trascrizio- 
ne di ciascun gene è controllata indivi- 
dualmente da una interazione tra enzimi, 
che intervengono nella trascrizione, e 
sequenze segnale, presenti nelle regioni 
non codificanti del DNA. La scarsità di 
questo DNA nel genoma mitocondriale 
umano suggerisce che la trascrizione deb- 
ba essere regolata in qualche modo insoli- 
to. In che modo tutto questo avvenga sta 



DNA MITOCONDRIALE DI LIEVITO 
THR CYS LEU 



fp ( eOSOMAL 



LYS 



PROTEINA ASSOCIATA A ' 
Al RIBOSOM 



SUBUNITÀ 
DELL'ATP 



CITOCROMO c- 
OSSIDASI II 



CITOCROMO c- 
i— -OSSIDASI III 




PICCOLO 
RNA RIBOSOMALE 



OSSIDASI I 



I mitocondri umani e quelli del lievito hanno essenzialmente la stessa 
serie di geni, mentre la toro organizzazione è diversa. I due DNA 
vengono raffigurati qui come doppi cerchi concentrici (un cerchio per 
ogni filamento della doppia elica), ma in scale diverse: la molecola del 
DNA di lievito è in effetti cinque volte più lunga di quella umana. 
L'intera sequenza nucleotidica del genoma umano è slata determinata 
da li. G. Barrelt e collaboratori; è anche noia la maggior parte della 
sequenza del lievito Saccharomyces cerevisiae, di cui rimangono inde. 
finiti alcuni segmenti (linee tratteggiate). I segmenti in colore mostrano 
l'estensione dei geni per proteine note (in verdegiallo e rosso), per gli 



RNA ribosomali (blu chiaro) e per gli RNA di trasporto (blu intenso), 
ognuno dei quali e marcato con l'abbreviazione per l'amminoacido spe- 
cifico; i segmenti in colore marrone indicano, infine, i moduli di lettura 
senza attribuzione (MLSA), presumibilmente geni che codificano per 
proteine che non sono slate ancora identificale. 11 genoma umano è 
estremamente compatto e presenta scarso DNA non codificante inter- 
calato tra i geni. Nel genoma del lievito, d'altra parte, vi sono lunghi 
segmenti non codificanti e parecchi geni sono interrotti da sequenze 
intercalari («introni»), alcune delle quali includono a loro volta dei 
moduli di lettura che non hanno ancora avuto alcuna attribuzione. 



105 



cominciando a essere chiaro, come risul- 
tato degli studi accurati condotti da At- 
tardi e collaboratori al California Insatu- 
re of Technology. Sembra che su ogni fi- 
lamento del DNA mitocondriale umano 
vi sia un unico importante promotore, o 
sito di inizio per la sintesi deU'RNA. Per- 
tanto, il prodotto primario della trascri- 
zione è una copia di RN A a tutta lunghez- 
za di ogni filamento, 1 due prodotti prima- 
ri della trascrizione vengono quindi scissi 
e danno gli RNA ribosomali, gli RNA di 
trasporto e gli RNA messaggeri che sa- 
ranno in seguito tradotti in proteine. La 
scissione può aver luogo anche mentre 
l'RNA viene sintetizzato. In assenza di 
DNA non codificante, quali siti nei pro- 
dotti primari di trascrizione vengono ri- 
conosciuti dagli enzimi che operano la 
scissione? I prodotti di trascrizione che 
danno luogo a RNA di trasporto si trova- 
no proprio a fianco di quasi ogni gene più 
lungo, e la scissione ha luogo esattamente 
all'inizio e alla fine di ogni sequenza che 
diventerà RNA di trasporto. Questo fa 
pensare che il prodotto primario del la tra- 
scrizione si ripieghi in modo tale che la 
forma caratteristica degli RNA di tra- 
sporto fornisca i siti di riconoscimento per 
gli enzimi che intervengono sulTRNA, 

Analogamente, la mancanza di uno 
spazio segnalatore attorno agli RNA 
messaggeri fa pensare a insolite strategie 
per il controllo della traduzione. Il segna- 
le per l'inizio della traduzione e lo stesso 
del codone per l'amminoacido metioni- 
na. Gli RNA messaggeri non mitocon- 
driali sono preceduti da sequenze che 
servono da siti di riconoscimento per i 
ribosomi. i quali si legano a esse e mar- 
cano cosi come segnale di «inizio» il suc- 
cessivo codone per la metionina. I ribo- 
somi mitocondriali umani devono essere 
in grado in qualche modo di riconoscere 
certi codoni per la metionina come co- 
doni di inizio, senza avvalersi di un pre- 
cedente sito di riconoscimento. 

Il problema di come arrestare la sintesi 
proteica alla fine del gene è più comples- 
so. Negli RNA messaggeri non mitocon- 
driali il termine della traduzione è segna- 
lato da uno di parecchi codoni terminator! 
di catena, tra i quali vi è UUA (U sta per 
uracìle, la base dell' RNA analoga alla 
timina). La maggior pane dei messaggeri 
mitocondriali umani o mancano di un 
codone terminatore di catena (conti- 
nuando così nel gene successivo e sovrap- 
ponendosi ad esso; questo gene è di solito 
un gene per un RNA di trasporto) oppure 
hanno un codone terminatore dì catena 
che viene troncato dalla scissione (media- 
ta dagli RNA di trasporto), descritta so- 
pra. I geni citati terminano tutti o con V o 
con UÀ. In che modo, allora, si forma il 
codone terminatore? L'RNA messaggero 
mitocondriale umano, come la maggior 
parte degli altri messaggeri eucarioti e 
«poliadenilato», vale a dire possiede una 
lunga coda di nuckotidi deiradenina, 
subito dopo il punto di scissione. Questa 
coda poli-A offre proprio quello che il 
meccanismo di traduzione richiede: un 
segnale di arresto UVA, 

Il DNA mitocondriale di lievito è tan- 



to prodigo quanto la sua controparte 
umana è parsimoniosa. Il genoma del 
lievito non è stato ancora completamente 
ricostruito come sequenza, ma sembra 
che questo DNA codifichi per due RNA 
ribosomali, circa 25 RNA di trasporto, 
sei proteine di membrana e più di dieci 
proteine non identificate. Nel lievito (in 
modo specifico nel lievito da panificazio- 
ne Saccharomyces cerevisìae). i geni sono 
dispersi su un DNA cinque volte più lun- 
go. Le sequenze codificanti sono separa- 
te da lunghi tratti di DNA, che consisto- 
no quasi interamente di nucleotidi delle 
basi A e 7". Almeno tre geni sono suddi- 
visi in segmenti da introni. Lunghe se- 
quenze all'inizio e alta fine dei geni sono 
trascritte, ma non tradotte. 

// codice non è universale 

Ogni codone dell 'RNA messaggero 
viene «tetto» dall'anticodone di un 
RNA di trasporto, che trasporta appun- 
to un amminoacido specifico da colloca- 
re in una catena proteica. Il codice ge- 
netico che correla ogni codone del DNA 
(o deU'RNA messaggero suo prodotto 
di trascrizione) con un particolare am- 
minoacido è esattamente lo stesso nei 
virus, nei batteri e negli animali, dai 
vermi all'uomo. Venne pertanto ritenu- 
to universale, ma in realtà non è così: i 
mitocondri ne hanno una propria ver- 
sione, che è soggetta a variazione nei 
diversi organismi. I mitocondri dei 
mammiferi leggono AGA e AGG come 
segnali di arresto e non come codoni per 
l'amminoacido arginina e traducono 
AUA come metionina e non come iso- 
leucina; AUA e AUU possono servire 
come segnali di inizio al posto di AUG. 
D'altra parte, nei mitocondri delle muf- 
fe Neurospora e Aspergillus, A GA, 
AGG e AUA vengono tradotti secondo 
il codice «universale*. Nel lievito, come 
nei mammiferi, AUA codifica per la 
metionina, mentre ì quattro codoni che 
cominciano con CU vengono letti come 
treonina invece che come leucina. Nei 
mitocondri dei mammiferi, del lievito, 
di Neurospora e di Aspergillus, l'ammi- 
noacido triptofano viene specificato, 
oltre che dai normale UGG, da UGA, 
mentre nel granturco il codone supple- 
mentare per il triptofano sembra essere 
CGG. 

Esistono 61 codoni (cioè 4', meno tre 
codoni terminaiori di catena), ma gli or- 
ganismi se la cavano con un minor nume- 
ro dì RNA di trasporto perché un solo 



RNA di trasporto è in grado di leggere più 
di un codone. E può farlo perché c'è una 
certa libertà (ossia un certo «ondeggia- 
mento») nell'appaiamento della terza 
base di un codone con certe basi nella 
prima posizione di un anticodone. Secon- 
do le regole dedotte alcuni anni fa da F. 
H. C. Crick, 32 RNA di trasporto (ma 
non meno) dovrebbero essere in grado di 
leggere i 61 codoni. Eppure l'analisi delle 
sequenze mostra che il DNA mitocon- 
driale umano codifica per soli 22 RNA di 
trasporto, il DNA mitocondriale di lievito 
per 25. Non sembra che altri RNA di 
trasporto siano importati da! citoplasma, 
eppure 61 codoni vengono letti. Come? 
Sembra che ciascuno dei 22 RNA di 
trasporto dei mitocondri di mammifero 
sia in grado di leggere una «famiglia» di 
due o quattro codoni sinonimi (si veda 
I "illustrazione a pagina HO), Gli RNA di 
trasporto per famiglie di due codoni 
avrebbero degli anticodoni ondeggianti 
convenzionali G:U, cioè degli anticodoni 
che cominciano con C, una base in grado 
di appaiarsi con U o con C, oppure che 
cominciano con U, una base che può ap- 
paiarsi con G o con A. Gli RNA dì tra- 
sporto per famiglie di quattro codoni 
ignorano, invece, le regole di Crick e leg- 
gono - a quanto pare - tutti e quattro i 
codoni sinonimi. I loro anticodoni hanno 
una U nella posizione 5'. O questa U si 
appaia in un certo modo con tutte e quat- 
tro le basi del codone 3' oppure gli ami- 
codoni leggono solo le prime due basi e 
ignorano l'ultima. La possibilità di questo 
processo di lettura «due su tre» è stata 
suggerita parecchi anni fa da Ulf Lagerk- 
vìst della Facoltà di medicina dell'Univer- 
sità di Goteborg. 

Un interessante interrogativo è come 
alcuni RNA di trasporto con la base U in 
posizione ondeggiante possano leggere - 
a quanto si sostiene - due codoni al posto 
di quattro. Che cosa li trattiene dal 
riconoscere i codoni che terminano con 
U o C. e cosi quelli che terminano con 
G o Al Nei mitocondri del lievito e di 
Neurospora e in molti RNA di trasporto 
non mitocondriali un simile riconosci- 
mento è reso impossibile da una modifi- 
cazione chimica dell'I/ ondeggiante, ma 
finora l'analisi delle sequenze degli RNA 
di trasporto mitocondriali animali non ha 
rivelato alcuna modificazione in tale po- 
sizione. La maggior parte di questi RNA 
di trasporto possiede, però, una struttura 
non convenzionale ed è forse proprio 
questa che influenza la specificità del- 
l'anticodone. 



CITOCROMO C-OSSIQASI I 



Un campione della sequenza nucleo ti dica ilei DNA mitocondriale umano si ricava dai dati raccolti 
da Barre» e collabora lori. Compaiono qui solo 2200 nucleotidi dell'intera molecola, costituita da 
ben 16 569 nucleotidi. Questo è sufficiente, tuttavia, a evidenziare come i geni siano disposili in 
modo compatto. In una regione (che comincia con il nucleotide numero 8527), due geni sono in 
realtà sovrapposti, cioè gli stessi nucleotidi svolgono un doppio compito, codificando la fine del 
modulo di lettura senza atlribuzione (MI.SA) che viene definita .46/., e l'inizio del gene per la 
subunità 6 dell' ATP-asi, (Il modulo di lettura è diverso, come viene indicato dalie due graffe.) La 
sequenza è quella del filamento che funge da codificante per là maggior parte dei geni illustrati e 
ha quindi la stessa sequenza dei corrispondenti RNA messaggeri e di trasporlo. L'RNA di 
trasporto per l'amminoacido serina è, in realtà, specificato dal filamento complementare, che 
viene trascritto nella direzione opposta, come indicato dalla corrispondente freccia nella figura. 



itcaggctacaccctag/ 



7100 



TAACTTTCTTCCCACAACACTTTCTCG 

CCTATCATCTGTAGGCTCATTCAT 

CCTAATAGTAGAAGAACCCTCCATAAACCT 




TCCATTTCACTATCATATTCATCGGCGTAA' 
^TCGGACTACCCCGATGCATACACCACATGAAACAT 



GAGAAGCCTTCGCTTCGAAGCG 




TGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATA 

74 00 < RNA DI TRASPORTO {SER)« ». 

aCCAACCCCATGGCCTCCATGACTTTTTCAAAAAGGTA 

CITOCROMO c-OSSIDASI II » 

ATCTTAATGGCACATGCAGCGCAAGTAGGTCTA 



I 

7600 



CAAGACGCTACTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCATAATCATTTTCCTTATCTGCTTCCTAGTCCTG 

I 

TATGCCCTTTTCCTAACACTCACAACAAAACTAACTAATACTAACATCTCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTQCC 

CGCCATCATCCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAA 

7800 

CAATTGGCCACCAATGGTACTGAACCTACGAGTACACCGACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCT 

IGATTGAAGCCCCCATTCGTATAATAATTACATCACAA 



1 
7900 



AGAACCAGCCGACCTGCGACTCCTTGACGTTGACAATCGAC 



8000 



GACGTCTTGCACTCATGAGCTGTCCC 



AAAACAGATGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCTA 



I 

8100 



8200 R NA PI TRASPORTO (LYS) » 

ACCCCCTCTACCCCCTCTAGAGCCCACTGTAAAGCTAACTTAGCATTAACC 



CACGACCGGGGGTATACTACGGTC, CAT6CCCATCGTCCTAGAATTAATTCCCCT 

AAAAATCTTTGAAATAGGG 
STTAA 

\TTATAACAAACCCTGAGAACC 




8500 



SIIBUNITÀ6 DELL'ATP-asi » 



CAAT 



g^^gGCCTACCCGCCGCAG 



TACTGATCATTCTATTTCCCCCTCTATTGATCCCCACCTCCAAATATCTCATCAACAACCGACTAATCACCACCCAACAATGACTAATCA 

B600 

AACTAACCTCAAAACAAATGATAACCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTTAATCATTTTTATTGCC 

l 

8700 



ACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACCCAACTATCTATAAACCTAGCCA 



TGGCCATCCCCTTATGAGC 



r 
8800 



GGGCACAGTGATTATAGGCTTTCGCTCTAAGATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTATCCCC 

ATACTAGTTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTACGCCTAACCGCTAACATTACTGCAGGCCACC 

i 
^^^^^^^^^^ 9000 

TACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCATCTTCACAATTCTAATTCTAC 

I 

9100 ^ 

TGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAGTAAGCCTCTACCTGCACGACAACACATAATGA 

— -> C ITO CROMO e- O SSIDASI Ili > 9200 

^CAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGCC 



106 



107 



RNA-POLIMERASI 
FILAMENTO / 

CODIFICANTE 

n :'~tt 

FILAMENTO. 
TRASCRIVENTE" 



RNA 



CITOCROMO t> 




CITOCROMO c-OSSIDASI III 



RNA RIBOSOMALI CITOCROMO c-OSSIDASI I SUBUNITA 6 DELLATP-asi 



Il DNA mitocondriale umano viene [rasi-ritto in RNA e simultanea- 
mente questo è trasformato per dar luogo agli RNA ribosomali. di 
trasporto e messaggeri maturi, secondo quanto afferma Giuseppe 
Attardi del California Inslitule of Technotogj. Lo schema ìndica in 
che modo viene trascritto il principale filamento codificante, partendo 
da un unico importante sito promotore (a sinistra), per dar luogo a un 



unico prodotto di trascrizione. Questo RNA viene poi tagliato In cor- 
rispondenza delle estremità delle sequenze per gli RNA di trasport» 
(rettangoli), che Rancheggiano praticamente ogni gene. Il prodotto di 
trascrizione iniziale e i suoi segmenti in seguito trasformati sono in- 
dicati in grigio. Gli RNA maturi sono invece indicati nei colori cor- 
rispondenti a quelli degli schemi delle tre precedenti illustrazioni. 



MLSA 1 
MLSA 2 
MLSA 3 
MLSA A 

CITOCROMO Ó 

CITOCROMO c- 
-OSSIDASI III 

SUBUNITA 6 
DELLATP-asi 



r 


DNA v 

RNA DI TRASPORTO 


^m 


a| a] ile 




HE 


TAO 




■■ 


T|G|G Gì 




^m 


T G T 




| | |t|g g | i - 




■ I 






T 





r~ 



RNA 



"\ 



TRASCRITTO 


]u|a|a| 




I [U 


AG 




1 


G G 




JJI 


G U 




IH! 






i m 






V A ! A | U | G 




POLIADENILATO 



| U| a| A 


A 




1 U|« 


A 




| u a|a 


A 






1 |U|A|A 


A 




■■h 


■'. 




| u a|a 


A 




U A A A 


A 



! codoni terminator! di catena, che segnalano la fine della traduzione 
in proteina, mancano in sette prodotti di trascrizione mitocondrìali 
umani. In alcuni la sequenza si imbatte in una sequenza codificante 
che si trova a valle; in altri il lerminalore che consta di tre nueleotidi, 
viene tagliato, e quindi troncalo, quando t'RNA viene sottoposto al 



processo di trasformazione. Il segnale necessario viene fornito in mo- 
do non convenzionale dalla poliadenilazione, un evento normale nella 
trasformazione dell'RNA, in cui una fila di adeninnucleotidi (A) viene 
aggiunta a ogni prodotto di trascrizione per ottenerne un RNA mes- 
saggero. In questo caso gli A ampliano il codone lerminalore UAA. 



Gli introni del lievito 

Geni suddivisi in segmenti separati 
(geni discontinui) furono scoperti per la 
prima volta nel 1977 ed è chiaro ormai 
che molti geni nei cromosomi dei mammi- 
feri, degli uccelli e degli anfibi (come pure 
alcuni geni di organismi eucarioti inferio- 
ri) sono di questo tipo, con sequenze in- 
tercalari non codificanti che interrompo- 
no gli «esoni» codificanti per una protei- 
na. Quando un gene di questo tipo si 
esprime, viene innanzitutto trascritto, in- 
troni e tutto il resto, in un RNA messag- 
gero precursore. Questo RNA viene 
quindi «rielaborato», cioè gli introni ven- 
gono tagliati ed eliminati e gli esoni ricon- 
giunti, o saldati (l'operazione viene detta 
con termine inglese splicing), così da co- 
stituire un RNA messaggero maturo, che 
viene tradotto in una proteina. Gli introni 
dei geni cromosomici, per quanto se ne sa, 
non codificano affatto. 



Nei mitocondri del lievito, le cose stan- 
no in modo diverso. Parecchi anni fa, 
Piotr P. Slonimsky e collaboratori del 
Centre de Génétìque Moléculaire di 
Gif-sur- Yvette, in Francia, trovarono che 
mutazioni a carico di un introne del gene 
mitocondriale del lievito per il citocromo 
b (uno degli enzimi respiratori) influivano 
sullo splicing dell'RNA trascritto da quel 
gene. Una serie di eleganti esperimenti 
genetici, accoppiati con l'analisi delle 
sequenze del DNA, ne hanno rivelato la 
ragione: l'eliminazione del secondo in- 
trone del gene è mediata da una proteìna 
che viene in parte specificata da un seg- 
mento dell'introne stesso! 

Varie forme del gene per il citocromo b 
sono state studiate ormai in differenti 
ceppi di lievito. La forma più complessa 
ha sei esoni (designati con le sigle da B\ a 
£6) e cinque introni. Tre introni includo- 
no lunghi moduli di lettura che non hanno 
ancora ricevuto un'attribuzione. L'intero 



gene si esprime in un lungo prodotto pri- 
mario di trascrizione. Quindi viene elimi- 
nato l'introne numero I. L'effetto di que- 
sta fase consiste nell'untre Tesone B 1 al- 
l'esone B2 e, nello stesso tempo, nel ren- 
dere accessìbile il modulo di lettura del- 
l'introne numero 2. cioè nel mettere le 
sue triplette in fase con quelle dei due 
precedenti esoni. 

Il prodotto di trascrizione di B 1 , di B1 e 
della porzione dell'introne numero 2 che 
costituisce un modulo di lettura funge ora 
da RNA messaggero: viene tradotto in 
una proteina la cui testa ammino-termi- 
nate comprende ì primi 143 amminoacidi 
del citocromo b (codificati da B 1 e B2) e 
la cui coda carbossilico-terminale è codi- 
ficata, invece, dal modulo di lettura del- 
l'introne. Questa strana proteina aiuta a 
catalizzare il taglio e l'eliminazione del- 
l'introne numero 2 e, nel far questo, di- 
strugge il proprio RNA messaggero e 
quindi limita il proprio livello nel mito- 



108 



condrio, Slonimski chiama questo feno- 
meno «meccanismo omeostatico basato 
sullo splicing», e definisce maturasi la 
proteina codificata dalla combinazione 
esone-introne, per indicare che può non 
essere di per sé un enzima in grado di 
catalizzare questo processo di resezione e 
saldatura, ma piuttosto un fattore che 
modifica in un certo modo la specificità di 
un preesistente enzima avente tale fun- 
zione, probabilmente un enzima codifica- 
to da un gene nucleare. 



Una volta Crick ha avanzato l'ipotesi 
che gli anelli di RNA potessero formarsi 
nel processo di resezione e saldatura ne! 
caso che un enzima fosse in grado di unire 
le due estremità di un singolo introne alla 
stessa stregua di come poteva unire due 
esoni. Finora, laddove il processo di rese- 



zione e saldatura dà origine a RNA circo- 
lari, è stata riportata solo l'una o l'altra di 
queste due circostanze. Nel nucleo del 
protozoo Tetrahymena, Thomas R. Cech 
dell'Università del Colorado, a Boulder, 
ha riferito alcuni anni fa assieme ai suoi 
collaboratori l'esistenza di un introne ad 



■ . "■■'•-■■--.. 



Piccoli RNA circolari 

La presenza di una RNA-maturasi 
spiega in modo inequivocabile il compor- 
tamento di numerosi mitocondri mutanti 
che presentano lesioni all'interno dell'in- 
trone numero 2. In essi i prodotti di tra- 
scrizione del gene per il citocromo b non 
possono venir rielaborati, e quindi si ac- 
cumulano lunghi RNA da cut è stato stac- 
cato solo il primo introne. Essi generano 
grandi quantità di proteine che danno una 
reazione crociata con gli anticorpi contro 
il citocromo b, ma che non sono citocro- 
mo b. La sintesi di tali proteine viene 
bloccata se nell'esone B I sono introdotte 
mutazioni che fanno terminare la sintesi 
proteica. Esse devono essere allora delle 
maturasi difettose, che derivano dalla 
traduzione degli esoni B 1 eB2 e del lungo 
modulo di lettura che è presente nell'ìn- 
trone numero 2. La loro produzione ec- 
cessiva è il risultato diretto della loro in- 
capacità di distruggere l'RNA messagge- 
ro che ha diretto la loro sintesi. 

Il meccanismo omeostatico basato sul- 
lo splicing non è probabilmente limitato 
al secondo introne del gene per il cito- 
cromo b. Gli introni numero 3 e 4 di quel 
gene e i primi quattro introni del gene per 
la subunità I della citocromo e -ossidasi 
(un'altra proteina della membrana inter- 
na) incorporano anch'essi lunghi moduli 
di lettura, resi accessibili, e vi sono prove 
che. nell'intervento su questi, siano inte- 
ressate maturasi specifiche per gli introni. 

Nei mitocondri, alcuni eventi di re- 
sezione e saldatura generano piccoli 
RNA ad anello insoliti, scoperti da 
Annika C. Arnberg dell'Università sta- 
tale di Groningen. quando collaborava 
con Gertjan van Ommen e con me in studi 
di microscopia elettronica, condotti allo 
scopo di riuscire a costruire mappe dei 
prodotti di trascrizione mitocondrìali. 
Risultò che tali anelli erano introni stac- 
cati da RNA precursori, e che in un se- 
condo tempo avevano formato anelli 
chiusi, a quanto pare grazie alla forma- 
zione di un legame chimico covalente. 
Essi sono stati associati oggi con i tre in- 
troni del gene per la subunità I della cito- 
cromo (--ossidasi e con un introne (l'in- 
trone numero 2, di cui si è già parlato) del 
citocromo b. L'anello associato al cito- 
cromo è e un altro associato a un introne 
con un lungo modulo di lettura, che non 
ha ancora avuto una attribuzione, sono 
staccati - a quanto pare - da maturasi 
codificate nei mitocondri, mentre il di- 
stacco degli altri due anelli può dipendere 
da enzimi codificati nel nucleo. 






***>-, ,*">* a ?^r?'W'A. 



'Wvv^vv 




A 1 



A 2 



DNA 



/ 1 



12 



A3 A4 A 5 A 6 A l 4 8,9.10 

I <3 ■ M 1 <5 | /6 1 17 B| 



18 19 



1 23456789 10 

l» MI II 



RNA MESSAGGERO 

Mediante microscopia elettronica è possibile ricostruire la mappa di questo gene discontinuo del 
DNA mitocondriale del lievito. La microfotografia, eseguita da Arnberg e Van Bruggen, e la 
mappa interpretativa sottostante mostrano una molecola ibrida: un singolo filamento di DNA, 
che incorpora il gene per la subunità 1 della citocromo e- ossidasi (linea in nero sulla mappa), è 
stalo fatto ibridare con l'RNA messaggero (in colore), trascritto da esso. Nel DNA, le sequenze 
che codificano per la proteina sono interrotte dagli introni. Le sequenze complementari nel DNA 
e nell'RNA si sono appaiate e formano regioni a duplice filamento; gli introni, non avendo 
controparte nell'RNA, formano anse a filamento singolo. Quando un gene di questo tipo si 
esprime, l'RNA prodotto primario della trascrizione viene «reciso e nuovamente saldato» per 
rimuovere gii introni e lasciare soltanto gli «esoni», o regioni che codificano per la proteina. Le 
informazioni che si ricavano dagli esperimenti di ibridazione sono state combinate con i dati 
ricavati dalle sequenze e raccolti da Alexander Tzagoloff della Columbia University e da Lambert 
A. M. Hensgens, che lavora nel laboratorio dell'autore, per rivelare l'organizzazione degli esoni 
(da 41 ad A 10) e degli introni (da/1 a/ 9) e dell'RNA messaggero maturo dopo rielaborazione 
(in basso). (Gli introni /8 e 19 sono troppo piccoli per distinguersi in una microfotografia.) 



109 



PRIMA 
LETTERA 


SECONDA LETTERA 


TERZA 
LETTERA 


U 


C 


A 


G 


a 


PHE 
PHE 


SEH 
SEP. 
SE A 
SÉR 


TYR 
TYR 


CYS 
CYS 


U 

c 

A 
G 


LEU 

LEU 


STOP 
STOP 


(STOP) 1 
TRP 


e 


LEU 
LEU 
LEU 
LEU 


PRO 
PRO 
PRO 
PRO 


HIS 
HIS 


ARG 
ARG 
ARG 
ARG 


U 

c 

A 
G 


GLN 
GLN 


A 


ILE 
ILE 


THfl 
THR 
THR 
THR 


ASN 
ASN 


SER 


U 

C 
A 
G 


(ILE) ME T 
MET 


LYS 
LYS 


ARG 
iARGI STOP 


G 


VAL 
VAL 
VAL 
VAL 


ALA 
ALA 
ALA 
ALA 


ASP 
ASP 


GLY 
GLY 

GLY 
GLY 


U 

C 
A 
G 


GLU 
GLU 



Il codice genetico, in cui una tripletta di nucleolidi ( designati dalle loro iniziali V,C,. 4 e G) funge 
da codone, specificando un particolare amminoacido o un segnale dì arresto (stop), veniva in 
passato ritenuto universale, mentre in realtà è diverso nei sistemi genetici dei mitocondri. La 
tabella qui sopra mostra in che modo le atlriburioni dei codoni deviìno nei mitocondri umani da 
quelle del codice «universale»; ogni deviazione mitocondriale viene indicata in colore, con la 
traduzione normale tra parentesi. Ciascuno dei 22 UNA di trasporlo presenti nei mitocondri 
umani «legge» o due codoni sinonimi (caselle in grigi/i) oppure quattro (caselle in colore). La 
reazione degli RNA di trasporto della meiionina nei confronti del codone non è ancora chiara. 



anello, staccato dal prodotto di trascri- 
zione de! gene per un RNA ribosorrtale. 
Quando tale gruppo cercò di identificare 
l'enzima che sembrava mediare questa 
resezione e circolarizzazione, giunse alla 
sorprendente conclusione che non esiste 
alcun enzima: sembra che la resezione e la 
circolarizzazione dipendano da proprietà 
intrinseche dello stesso RNA. L'RNA di 
Tetrahymena è l'unico esempio finora 
conosciuto di quello che Cech chiama un 
ribozima: cioè un RNA in grado di ta- 
gliarsi e saldarsi da sé. Ulteriori studi sugli 
anelli, presenti nei mitocondri e che non 
richiedono la presenza di maturasi per il 
distacco, dovrebbero riuscire a rivelare se 
anche nel loro caso sono interessati dei 
ribozimi. 

Perché gli introni? 

Una notevole proprietà della maturasi 
associata con l'introne numero 2 è la sua 
non essenzialità. Ceppi di lievito con ver- 
sioni più brevi del gene per il citocromo b 
sono comuni e tali geni mancano spesso 
dei primi tre introni; gli esoni, quindi, da 
B\ a B4 risultano fusi. L'informazione 
originariamente presente negli introni 
mancanti non si trova altrove nel genoma 
mitocondriale del lievito, il che fa pensare 
che la maturasi sia l'equivalente mitocon- 
driale del peggio r tipo di burocrate: una 
persona che esiste solo per occuparsi della 
propria esistenza. In realtà, i tre introni 
mancanti sono membri di una classe di 
introni mitocondriali del lievito, definiti 
«opzionali» da Johan Sanders mentre si 
trovava nel nostro laboratorio presso 
l'Università di Amsterdam, alcuni anni 



orsono. Altri esempi si possono rilevare 
nei geni per il maggiore dei due RNA 
ribosomali e per la subunità 1 della cito- 
cromo e -ossidasi. Per classificare come 
opzionale un introne basta semplicemen- 
te trovare un ceppo che ne sia privo e che 
sia tuttavia funzionale. Finora è stato 
esaminato solo un numero limitato di 
ceppi di lievito, ma può darsi che, alla 
fine, tutti gli introni mitocondriali di lievi- 
to risultino opzionali. La natura opziona- 
le di anche solo pochi introni pone in una 
nuova luce alcune questioni fondamenta- 
li: Perché alcuni geni sono discontinui e 
altri no? Perché lo stesso gene esisterebbe 
sìa nella forma continua sia nella forma 
discontinua? Da dove derivano gli introni 
opzionali, e gli introni in generale? 

Walter Gilbert della Harvard Universi- 
ty ha sostenuto che, nei genomi nucleari e 
virali, gli introni possono conferire un 
vantaggio selettivo, promuovendo una 
evoluzione più rapida. Aumentando no- 
tevolmente la lunghezza di un gene, essi 
aumentano la probabilità dì vari eventi di 
ricombinazione in cui si interscambi a no 
segmenti analoghi di due allei i. o versioni 
alternative dello stesso gene. Una ricom- 
binazione del genere potrebbe riunire in 
un unico allele due mutazioni vantaggio- 
se, presenti ciascuna in un diverso allele. 
cosi da creare un gene doppiamente van- 
taggioso. Potrebbe anche creare geni 
completamente nuovi grazie a quello che 
Gilbert chiama «il rimescolamento degli 
esoni», cioè riunendo come esonì di un 
singolo gene parecchie sequenze codifi- 
canti, che in precedenza avevano specifi- 
cato differenti proteine. Inoltre, una mu- 
tazione in una singola base in corrispon- 



denza del limite tra un introne e un esone 
può modificare la modalità di resezione e 
saldatura e, pertanto, generare RNA 
messaggeri, che codificano per proteine 
molto diverse. 1 cambiamenti indotti da 
tali mutazioni nella resezione e saldatura 
non devono necessariamente essere asso- 
luti, e quindi il DNA colpito può diventa- 
re un gene «con molteplici scelte»: può 
codificare sia per la proteina originaria sìa 
per quella nuova, a seconda degli eventi 
di resezione e saldatura che sì pongono in 
alternativa, il che permette all'organismo 
di provare una soluzione, senza cancella- 
re dalla sua memoria la vecchia soluzione. 

In che modo compaiono gli introni? 
L'introduzione di sequenze estranee in un 
gene essenziale è di solito letale. Anche 
se un meccanismo di elaborazione del- 
l'RN A elimina tali sequenze dal prodotto 
primario di trascrizione di un gene, per- 
ché forze selettive dovrebbero conservare 
un introne appena introdotto? La cellula 
non trae alcun vantaggio immediato dalla 
presenza di una sequenza intercalare e 
certamente non può prevedere che essa le 
sarà utile in avvenire. Queste considera- 
zioni hanno indotto W, Ford Doolittle HI, 
della Dalhousìe University nella Nuova 
Scozia, a proporre che gli introni non sia- 
no mai stati introdotti nelle cellule euca- 
riote, ma facciano piuttosto parte della 
loro eredità evolutiva. 

Secondo Doolittle. gli attuali procarioti 
(cioè i batteri), come pure il nucleo delle 
cellule eucariote, sono probabilmente 
derivati da un organismo ancestrale pri- 
mitivo in grado di evolversi rapidamente 
in quanto possedeva un meccanismo di 
duplicazione e trascrizione del DNA, ol- 
tre che di traduzione, poco preciso e non 
fedele. L'informazione genetica di un 
simile organismo avrebbe dovuto essere 
codificata in modo ridondante perché una 
parte qualsiasi di essa potesse essere 
espressa in modo corretto. Una organiz- 
zazione fatta di geni frammentati potreb- 
be essere stata essenziale per assicurare 
che ì prodotti di trascrizione degli esoni 
venissero almeno occasionalmente riuniti 
per dirigere la sintesi di proteine funzio- 
nali. Sempre secondo Doolittle, a mano a 
mano che il meccanismo genetico diven- 
tava più accurato, una simile precauzione 
diventò meno necessaria; la duplicazione 
e la trascrizione del DNA ridondante e 
non informazionale divennero sempre 
più onerose e ci fu una pressione per eli- 
minarle. Il vantaggio di questa elimina- 
zione fu una maggiore efficienza cosi 
come viene esemplificata dai geni sempli- 
ficati dei moderni batteri e dei virus che li 
infettano. Il prezzo pagato è stata la per- 
dita di una certa potenzialità di ulteriore 
cambiamento evolutivo. 

Che dire degli introni nei geni mito- 
condriali? Molte delle proposte avanzate 
per spiegare gli introni dei geni nucleari 
non sono soddisfacenti per i geni mito- 
condriali, non solo perché non spiegano i 
moduli di lettura che non hanno ancora 
ricevuto una attribuzione, ma anche per- 
ché le principali previsioni non sono com- 
provate dai fatti. La ritenzione passiva di 
introni con moduli di lettura senza auri- 



no 



RNA 
NON 



01 TRASPORTO 
MITOCONDRIALE TIPICO 



RNA DI TRASPORTO MITOCONDRI ALI 



3' SITO DI 

- ATTACCO 
£J DELL'AMMINOACIDO 
C 
C 



*m 




ANTICODONE 
5' CODONE 




TRE0N1NA 




I C |G| A | 5 1 CODONI 

PER LA SERINA 



U I S I M 





"- 


A| 


|u 


e 


Al 


le 


E 


*l 


le 


: 


*! 



CODONI PER 
LA TREONINA 



Gti RNA di trasporto hanno in genere una struttura stereotipala a 
trifoglio (a sinistra), il che deriva da un appaia mento (linee in grìgio) tra 
basi nudeotidiche complementari. (Nell'RNA ,-1 si appaia con l'eC con 
C. Negli RNA di trasporto mitocondriali illustrati qui, la sequenza è 
queDa del DNA più che dell' RNA e così si nota che A si appaia con T.) 
Molti RNA dì trasporto mitocondriali limino, inoltre, una forma aberran- 
te: quello per la strina (al centro) manca di un intero braccio. Un 



anticodone di tre nudeotidi su ciascun RNA di trasporto legge un codone 
deD'RNA messaggero. In alcuni casi, un RNA di trasporto può leggere 
più di un solo codone perché, nell'appaiamento tra la prima base del 
suo anticodone e la tema base di un codone vi è una certa liberta, n 
«ondeggiamento». La A' dell'anticodone a sinistra potrebbe appaiarsi con 
una base diversa da X . Molti RNA di trasporto nei mitocondri umani 
possono leggere ■ a quanto pare - Tino a quattro codoni (a destra). 



81 M 82 12 S3 (3 B4 14 05 *5 B6 



RNA 




RNA- 
- MATURASI 



8 1 B2 83 /3 B4 14 S5 (5 S6 



SUCCESSIVA V 
ELABORAZIONE J, 

Si S 2 B3 



8 4 8 5 8 6 



RNA MESSAGGERO 



La RNA-malurasi, un enzima specificato in parte dal secondo introni- 
del gene mitocondriale del lievito per il citocromo 6, aiuta a catalizza- 
re il taglio dell'introne che la codifica. Il gene possiede sei esoni (da il 1 a 
B6) e cinque introni. (Gli esoni e gli introni non sono rappresentati in 
questo grafico alla stessa scala.) Esso viene trascritto in un RNA 
precursore, da cui il primo introne è rapidamente eliminato median- 
te un enzima, codificato nel nucleo, e in grado di recidere e saldare il 



DNA. (Si accumularlo - fatto sorprendente - copie dell'introne sotto 
forma di anelli a filamento singolo.) Il taglio finisce per unire gli esoniz? 1 
i- H2 a un lungo modulo di lettura all'interno dell'introne II (in grìgio), 
modulo che non ha ancora ricevutounaattribuzione.L'RNAcosi riunito 
funge da RNA messaggero, che specifica la maturasi, necessaria per il 
taglio ài II. La maturasi controlla in questo mudo la propria sintesi. Vi 
sono prove che altre maturasi contribuiscano al taglio di lì e di /4. 



112 



huzione non è una buona spiegazione, 
perche il costo per la cellula che deve 
mantenere ed esprìmere i numerosi geni 
necessari per staccare gli introni e notevo- 
le e un complesso sistema di questo gene- 
re deve essere molto vulnerabile alla 
demolizione per mutazione. La ritenzio- 
ne per facilitare la ricombinazione è una 
spiegazione improbabile, dato che non 
esistono indicazioni che i nuovi geni mito- 
condriali siano sorti di recente in seguito 
al rimescolamento degli esoni o che pro- 
teine codificate nei mitocondri si stiano 
evolvendo nei funghi in modo più rapido 
delle loro controparti nei mitocondri dei 
mammiferi, i cui geni non hanno introni, 
Inoltre, anche se in teoria il rimescola- 
mento degli esoni è un modo eccellente 
per diffondere mutazioni che conferisco- 
no caratteri vantaggiosi (ad esempio, la 
resistenza a inibitori naturali della fun- 
zione mitocondriale). non vi è alcuna ra- 
gione per credere che tali mutazioni si 
fissino più efficacemente nei geni discon- 
tinui che nei geni continui. Infine, non vi 6 
alcuna indicazione (anche se esistono dati 
validi qua e là) che qualunque gene di- 
scontinuo nei mitocondri di lievito sia un 
gene dalle molteplici scelte. 

Gli introni e Iti repressione 

Gli introni con moduli di lettura che 
non hanno avuto alcuna attribuzione 
sono stati forse conservati, allora, nel 
DNA mitocondriale dei funghi, perché 
conferiscono un certo tipo di vantaggio 
selettivo. Quale potrebbe essere tale van- 
taggio? Una spiegazione plausibile, forni- 
ta da Piet Borst dell'Università di Am- 
sterdam, è che introni di questo tipo pos- 
sono svolgere un ruolo nella regolazione 
fine dell'espressione dei geni mitocon- 
driali. Le cellule di lievito possono repri- 
mere selettivamente la sintesi di certe 
proteine mitocondriali, quando crescono 
per fermentazione in assenza di ossigeno, 
e una parte di tale repressione può realiz- 
zarsi a livello della trasformazione del- 
l'RNA. La proposta avanzata da Borst ha 
il vantaggio di spiegare perché la repres- 
sione sia selettiva: geni come quelli per il 
citocromo h e per la subunità t della cito- 
cromo c-ossidasi, che possiedono parec- 
chi introni, il cui distacco è probabilmente 
sotto il controllo di una maturasi, dovreb- 
bero essere particolarmente sensibili alla 
repressione ed è proprio questo che è sta- 
to trovato. L'argomento della repressione 
non spiega, però, l'esistenza di tutti gli 
introni mitocondriali del lievito. Non bi- 
sognerebbe lasciarsi sfuggire l'eventualità 
che almeno alcuni di quelli privi di moduli 
di lettura senza attribuzione potrebbero 
non avere affatto una funzione. Dato un 
meccanismo efficace per rimuoverli dal- 
l'RNA. potrebbe esservi una scarsa pres- 
sione selettiva per eliminarli dal DNA. I 
mitocondri potrebbero, in effetti, non 
avere il congegno necessario per svolgere 
quest'operazione in modo efficace. Gli 
introni potrebbero essere una forma di 
«DNA egoista», che perpetua se stesso 
per la propria salvezza. 

Il fatto che alcuni introni nei mitocon- 



dri di lievito, di Aspergitlus e e di Neuro- 
spora si trovino, nei geni che scindono, in 
siti strettamente corrispondenti fa pensa- 
re che gli antenati comuni dei geni possa- 
no aver avuto una organizzazione analo- 
ga. Dunque, perlomeno questi introni 
possono riflettere direttamente l'organiz- 
zazione a geni frammentati, propria del 
primitivo organismo endosimbiotico. da 
cui si pensa che si siano evoluti i mitocon- 
dri. Tuttavia, non tutti gli introni possono 
essere cosi vecchi. Confronti minuziosi di 
sequenze di introni nei lieviti, realizzati 
da Francois Michel e da Bernard Dujon 
del Centre de Génétique Moléculaire e da 
Linda Bonen dell'Università di Amster- 
dam rivelano molte similitudini sia nella 
struttura secondaria dell'RNA sia nelle 
sequenze che codificano per le proteine. 
Queste similitudini inducono con molta 
forza a credere che la maggior parte degli 
introni attuali e i loro moduli di lettura 
senza attribuzione siano membri di una 
famiglia multigenica, che ha avuto la sua 
origine in un unico gene ancestrale e si è 
poi espansa, nel eorso dell'evoluzione, 
mediante duplicazione e trasposizione. 

Questa duplicazione con mobilità è 
caratteristica del comportamento dei tra- 
sposoni, frammenti di DNA che, nei bat- 
teri e negli organismi superiori, si dupli- 
cano e inseriscono le loro copie in corri- 
spondenza di siti casuali di un genoma. 
Gli introni molto simili del lievito hanno 
probabilmente avuto origine da essi. Se è 
avvenuto cosi, ciò spiegherebbe l'origine 
delle maturasi. La maggior parte dei tra- 
sposoni batterici codifica per una traspo- 
sasi, enzima che catalizza l'inserzione del 
trasposone. La trasposizione comporta 
una resezione esattamente in corrispon- 
denza delle due estremità del trasposone, 
proprio come la resezione e saldatura 
dell'RNA esige tagli netti in corrispon- 
denza delle estremità di un introne. Le 
maturasi potrebbero, dunque, essersi 
evolute dalle trasposasi. 

Perché DNA mitocondriale? 

Perché un sistema genetico separato 
dovrebbe servire solo per un organetto 
cellulare in mezzo a molti? Il sistema mi- 
tocondriale non può venir spiegato come 
una forma di amplificazione genica, ne- 
cessaria per rifornire il mitocondrio di 
forti quantità di certe proteine. Elevati 
livelli di sintesi proteica si possono rag- 
giungere con altri mezzi e, se l'amplifica- 
zione si rendesse necessaria, potrebbe 
anch'essa aver luogo nel nucleo. Né il 
DNA mitocondriale può venir spiegato 
come ta fonte indispensabile di proteine 
che sono troppo insolubili per essere tra- 
sportate in corrispondenza del loro sito 
nella membrana interna. La subunità 9 
del complesso ATP-asi, una delle protei- 
ne più idrofobe specificate nel lievito dal 
DNA mitocondriale, è specificata da un 
gene nucleare sia in Neurospora sia nei 
mammiferi, quindi sintetizzata sui ribo- 
somi presenti nel citoplasma e. infine, 
importata nei mitocondri. 

Se un sistema genetico mitocondriale 
separato non e necessario, perché esiste? 



I POLIMERI 

IjE, ^(^IK.XaK edizione italiana dì 

SCIENTIF1C VVIIIRICYN 

ha pubblicato alcuni articoli su 

aspetti particolari della chimica 

delle macromolecole: 



POLIMERI INORGANICI 

di H- R. Allcock (n. 7(1 1 

/ polimeri ìnorganù i. ancata In fase di 

studio, presentimi/ caraneristiche insolite e 

diverse da quelle dei polimeri organisi 
impiegati nell'industria. 



o 



LA M1CROSTRUTTURA 
DEI MATERIALI POLIMERICI 

di D. R. liuhlmann e A, Ci. Kolbeck 

(n. 92) 

/ progressi nella produzione di polimeri 

sintetici dipenderanno siti da una migliore 

conoscenza della loro complessità 

chimico, sia dalla realizzazione dì 

tecniche più raffinate per controlline 

il loro ordinamento molecolare. 



o 



I SILANI ORGANO-FUNZIONALI 

di G. Fantini (n. 1 Lì) 

Questi derivali del silicio, aumentando 

l'adesione fra matrici organiche di tipo 

polimerico e cariche inorganiche, 

migliorano notevolmente le proprietà 

meccaniche di vari materiali compositi. 



o 



I POLIMERI FUNZIONALIZZATI 

dì S. Leghissa (n. 140) 

Rappresentano il secondo aspetto della 

chimica macromolecolare dopo e accanto 

a ij nello più noto delle maierie plastiche, 

t loro impieghi sì irradiano sa campi 

diversi e di alto interesse per la nostra 

vita futura. 



113 




[1 DN V mitocondrialv insol ilo tk- 1 protozoo Trypanosoma brucei appare 

ingrandito di t irta Iti MIO dia metri in quesla microf olografia eletl remica 
<.--i-iiiiil.i d.il. H. tfoeimakers dell'I niversità ili Vmsterdam. Il f IN \ è in 
Case di segrega/itine: dopo essersi duplicato, sì iti vi ile formando due 



genomi che si separano quando l'organetto stesso si divide. Si presenta 
come un groviglio di maiianclli (freccia in nero) e minianelli (freccia in 
negaiìrv). Semhra che i maxianelli siano equivalenti al DNA ntitocon- 
d ria le dì altri organismi; la funzione dei minianelli non è ancora nota. 



Borst ritiene che il DNA mitocondrìale 
sia semplicemente un vicolo cieco evolu- 
tivo, ciò che rimane del l'ipotetico batterio 
simbiotico. Secondo la sua ipolesi, nei 
primi stadi dell'evoluzione esistevano 
scarse barriere al trasferimento dell'in- 
formazione tra il sistema genetico del- 
l'cndosimbionte e quello dell'ospite; 
quindi gradatamente la maggior parte dei 
geni dell'endosimbionte divennero parte 
integrante del genoma della cellula ospi- 
te. A mano a mano che la cellula eucario- 
ta divenne più sofisticata (cioè a mano a 
mano che il suo DNA si organizzò in cro- 
mosomi e fu segregato in un nucleo), e 
forse ì codici genetici nucleare e mitocon- 
driale si differenziarono l'uno dall'altro, 
la probabilità del trasferimento diminuì e, 
alla fine, divenne impossibile. Pochi geni 
rimasero, dunque, isolati nel mitocondrio 
e. poiché sono essenziali, persistono. 

L'ipotesi attrae per la sua semplicità. 
Essa spiega perfettamente il fatto che un 
certo numero di enzimi mitocondriati 
codificati nel nucleo abbiano somiglianze 
con corrispondenti enzimi presenti nei 
batteri. Essa prevede che alcuni geni si 
troveranno nei DNA mitocondrìale di un 
organismo e nel DNA nucleare dì un al- 
tro, come nel caso del gene per la subunita 
9 dell' ATP- asi. Contempla anche situa- 
zioni intermedie in cui le versioni sia mi- 
tocondrìale sia nucleare dello stesso gene 
sono presenti nella stessa cellula. Ciò può 
valere per Neurospora, in cui Paul van 
den Boogaan ed Etienne Agsteribbe del- 
l'Università statale di Groningen hanno 
trovato copie del gene per la subunità 9 
dell'ATP-asi sia nel DNA mitocondrìale 
sia in quello nucleare. 

L'ipotesi di Borst prevede inoltre che 
alcuni DNA mitocondriali possano avere 
un numero di geni maggiore di quello che 
si trova nella serie di base presente sia nei 



mitocondri di lievito sta in quelli di mam- 
mifero. I mitocondri delle piante superio- 
ri hanno genomi estremamente cospicui, 
che vanno da circa 250 000 nucleotidi nel 
granturco ad anche 2.4 milioni nella fa- 
miglia delle cucurbitacee. Buona parte 
della differenza può essere dovuta alla 
presenza di DNA non codificante, ma 
esperimenti di laboratorio mostrano che i 
mitocondri delle piante sintetizzano più 
proteine delle loro controparti presenti 
nei funghi o nei mammiferi. Vi è. inoltre, 
una valida testimonianza che. nelle pian- 
te, il fenomeno della sterilità maschile 
(incapacità di produrre polline fertile) 
può essere il risultato di cambiamenti a 
carico del DNA mitocondrìale. 

L'evoluzione verso la diversità 

Mentre i principali prodotti dei geni 
mitocondriali sembrano essersi in gran 
parte conservati nel corso dell'evoluzio- 
ne, lo stesso non vale per l'organizzazione 
e il modo di esprimersi di quei geni. La 
diversità dell'organizzazione viene esem- 
plificata nel migliore dei modi nel DNA 
mitocondrìale di Trypanosoma, un gene- 
re di protozoi unicellulari che include 
parassiti dell'uomo e degli animali dome- 
stici. Il DNA è un enorme groviglio di 
anelli legati (forse diecimila). Vi sono dei 
maxìanelli. la cui lunghezza varia tra 
20 000 e 36 000 nucleotidi. Hanno re- 
gioni omologhe con frammenti dì DNA di 
lievito e vengono trascritti. Sono proba- 
bilmente la controparte del DNA mito- 
condriale. presente in altri organismi. La 
maggior parte del DNA, però, consiste di 
minianelli, la cui lunghezza è inferiore ai 
3000 nucleotidi. Questi minianelli non 
vengono trascritti e hanno subito l'evolu- 
zione a una velocità elevata, tìpica del 
DNA non codificante. La funzione del 



vasto groviglio di minianelli non è nota, 
né è affatto chiaro il perché il DNA mito- 
condrìale del tripanosoma dovrebbe ave- 
re una così insolita struttura. 

Questa escursione finale a uno degli 
avamposti della biologia convincerà il let- 
tore (lo spero) che i sistemi genetici mito- 
condriali sono diversi. La loro varietà è il 
risultato di una elevata velocità di evolu- 
zione della sequenza nucleotidica, forse 
superiore di dieci volte alla velocità di evo- 
luzione per i geni contenuti nel nucleo. La 
chiara mancanza di limitazioni all'evolu- 
zione delle sequenze può essere messa in 
rapporto con la semplicità del sistema. La 
sua funzione è in primo luogo quella di 
sintetizzare un limitato numero di proteine, 
i n quan t i t ali vi pi uitosto cost antiepotrebbe 
essere anche in grado dì favorire mutazioni 
che sarebbero deleterie in un sistema adat- 
tato alla regolazione differenziale di molti 
geni. È anche possibile che in ciascun orga- 
nismo differenti pressioni selettive abbiano 
sospinto i DNA mitocondriali verso solu- 
zioni diverse, e talvolta estreme, del pro- 
blema della espressione genica. 

Il trovare che cosa sono queste pressio- 
ni potrebbe essere uno dei compiti per il 
futuro. Un altro compito potrebbe essere 
l'imparare, attraverso lo studio di questo 
sistema limitato, quali sono esattamente 
le richieste minime per un sistema geneti- 
co funzionale. Una miglior comprensione 
del genoma mitocondrìale dovrebbe rive- 
lare alcune delle vie evolutive che porta- 
no ai meccanismi di espressione genica 
nei batteri e negli eucarioti del mondo 
contemporaneo. A giudicare da quello 
che lo studio dei mitocondri ha già rivela- 
to, le lezioni da imparare circa l'organiz- 
zazione e l'espressione del DNA mito- 
condrìale dovrebbero avere applicazioni 
che si estendano ben oltre la membrana 
limite di questo modesto organello. 



114 



TEMI METAMAGICI 



di Douglas R. Hofstadter 



La ricorsività nel Lisp, il linguaggio 
dell'intelligenza artificiale 



Ho terminato l'articolo del mese 
scorso con una notizia recentis- 
sima sul porscopino glazunkia- 
no e ho pensato, quindi, che il miglior 
modo per iniziare l'articolo di questo 
mese fosse quello di aggiungere qualcosa 
su questo animale poco noto ma decisa- 
mente interessante. Come ricorderete, gli 
aculei di ciascun porscopino (tranne quel- 
li più piccoli) sono porscopini di dimen- 
sioni minori. Il più piccolo dei porscopini 
non ha aculei ma un naso, e un naso molto 
importante dal momento che i glazunkia- 
ni basano il loro sistema monetario su tale 
piccolo oggetto. Prendiamo in considera- 
zione il valore dei porscopini di 3 centi- 
metri della Glazunkia Esterna. Ciascun 
porscopino ha sempre nove aculei (men- 
tre i suoi cugini della Glazunkia Interna 
ne hanno sempre sette) e, pertanto, nove 
porscopini di due centimetri appuntati sul 
proprio corpo. Ciascuno di essi, a sua vol- 
ta, ostenta nove porscopini da un centi- 
metro da cui si dipartono nove porscopini 
da zero centimetri, ciascuno dei quali ha 
un naso. In totale si hanno 9 x 9 x 9 x 1 
nasi, vale a dire che un porscopino di 
3 centimetri della Glazunkia Esterna ha 
un potere d'acquisto di 729 nasi. Se ci 
fossimo trovati invece nella Glazunkia 
Interna e avessimo cominciato con un 
porscopino di quattro centimetri, esso 
avrebbe avuto un potere d'acquisto di 
7x7x7x7x1 ossia 2401 nasi. 

Vediamo se possiamo trovare una re- 
gola generale per calcolare il potere 
d'acquisto (misurato in nasi) di ciascun 
porscopino. Si potrebbe avere: 

Il potere d'acquisto di un porscopino con 
un dato numero di aculei e una determi- 
nata dimensione è: 
se è di dimensione 0, sarà 1 
altrimenti si trovi il potere d'acquisto di 
un porscopino con lo stesso numero 
di aculei ma di dimensione immedia- 
tamente inferiore a quella del por- 
scopino dato e lo si moltiplichi per il 
numero degli aculei. 



Possiamo abbreviare la regola servendoci 
di una notazione simbolica. Sia «a» il 
numero degli aculei e «d» la dimensione. 
Poniamo poi che «cond» stia per «se» e 
«t» per «altrimenti». Si usi infine una spe- 
cie di notazione algebrica condensata in 
cui i nomi delle operazioni vengano messi 
a sinistra dei loro operandi all'interno di 
parentesi. Otteniamo allora: 

(potere d'acquisto a d) è: 
cond (eq d 0) I ; 
t (times 
a 

(potere d'acquisto 
a 
(predecessore d))) 

Questa è una esatta traduzione della pre- 
cedente regola in una forma leggermente 
più simbolica. Possiamo renderla un po' 
più compatta e simbolica adottando un 
paio di nuove convenzioni. Poniamo cia- 
scuno dei due casi (quello in cui d è uguale 
aOe il caso «altrimenti») tra parentesi; in 
generale, si usino le parentesi per rac- 
chiudere ciascuna unità logica. Si indichi 
poi con le parole «def» e «lambda» che si 
tratta della definizione di una nozione 
generale detta «potere d'acquisto», con 
due variabili (numero degli aculei a e 
dimensione d). Abbiamo allora la seguen- 
te definizione: 

(def potere-di-acquisto 
(lambda (a d) 
(cond ((eq d 0) 1 ) 
(t 

(times a 
(potere-di-acquisto a 

(predecessore d))))))) 

Abbiamo detto prima che il potere 
d'acquisto di un porscopino a nove acu- 
lei di 3 centimetri è 729 nasi. La cosa 
si può esprimere nel modo seguente: 
(potere-di-acquisto 9 3) è uguale a 729. 
Analogamente (potere-di-acquisto 7 4) 
è uguale a 2401 . 



'T'orniamo al Lisp. Quasi alla fine del- 
*- l'articolo del mese scorso vi avevo 
proposto un rompicapo che richiedeva 
di scrivere una funzione Lisp che rias- 
sumesse una famiglia di funzioni come 
«quadrato», «cubo», «4 H potenza», «5 a 
potenza» e così via. Vi chiedevo di riu- 
scire a definire una funzione generale 
chiamata «potenza» con due variabili, 
tale che «(potenza 9 3)» dia 729, «(po- 
tenza 7 4)» dia 2401 e così via. Avevo 
presentato una «torre di potenze», cioè 
una torre infinitamente alta di defini- 
zioni Lisp distinte, una per ciascuna 
potenza, all'interno delle quali ogni vol- 
ta c'è un riferimento alla potenza pre- 
cedente. Allora un piano tipico di que- 
sta torre potrebbe essere: 

(def 102-esima-potenza 
(lambda (a) 
(times a (101-esima-potenza a)))) 

Ovviamente la I01 es,ma potenza si riferi- 
rebbe alla 100"" 1 " nella sua definizione e 
così via creando in tal modo un regresso 
piuttosto lungo fino ad arrivare al caso 
«embrionale» o più semplice. Sia detto 
per inciso: il caso più semplice non è 
«quadrato» o «prima potenza» ma 

(def 0-esima-potenza (lambda (a) I)) 

Ho detto che avevate tutte le informazio- 
ni necessarie per mettere insieme la defi- 
nizione giusta. Dovevate soltanto preoc- 
cuparvi, ovviamente, di basare ogni piano 
della torre su quello che è il «predecesso- 
re immediato» o «predecessore» (tranne 
nel caso del piano terra che è un piano 
«che si sostiene dasolo»). Per «predeces- 
sore» intendo: 

(def predecessore 
(lambda (d) (difference d 1 ))) 

Allora «(predecessore 102)» è 101. In 
realtà il Lisp ha un nome standard per 
questa funzione, precisamente «sub 1 » e 
un nome anche per la sua inversa, la 
funzione successore, cioè «add I». Se 
mettiamo insieme tutte queste osser- 
vazioni otteniamo la seguente defini- 
zione universale: 

(def potenza 
(lambda (a d) 
(cond ((eq d 0) 1 ) 
(t 

(times a 
(potenza a 

(predecessore d))))))) 

Questa è la risposta al rompicapo che 
vi avevo posto. Ehm, è buffo... Ho 
una stranissima impressione di déjà vu. 
Come mai? 

T a definizione che ho presentato è detta 
-1— ' ricorsiva perché nella definizione si 
usa ciò che si deve definire, ossia si defini- 
sce qualcosa nei termini di se stesso. La 
cosa sarebbe considerata circolare, per 
non dire del tutto scorretta, da parte di 
chiunque. Per rendeisiconto se il genietto 



116 



del Lisp guarda con sospetto tale furberia, 
chiediamogli di eseguire (potenza 9 3): 

— > (potenza 9 3) 
729 

— > 

Incredibile! Niente da dire? Nessuno 
shock? Come può il genietto del Lisp 
avallare un tale nonsenso? 

La migliore spiegazione che io possa 
dare è che la cosa non comporta, in realtà, 
nessuna circolarità. Anche se è vero che la 
definizione di «potenza» usa la parola 
«potenza», le due occorrenze si riferisco- 
no a circostanze differenti . I n poche paro- 
le, (potenza a d) è definito in termini di un 
caso più semplice, vale a dire (potenza a 
(predecessore d)). Sto allora definendo la 
44"' raa potenza in termini di 43 es,ma poten- 
za e quest'ultima in termini della potenza 
immediatamente inferiore e così via di- 
scendendo la linea fino alla «base» . come 
la chiamo io: la esima potenza, che non ha 
bisogno di alcuna recursione. È sufficiente 
direalgeniettocheilsuovaloreè l.cosache 
abbiamo puntualmente fatto. Quindi, a 
guardar bene, questa definizione ricorsiva 
none piùcircolarediquelche fosse la «torre 
di potenze» e non ne potete trovare un 'altra 
più corretta. Questa definizione compattaè 
proptio quello che ci vuole per contenere 
l'intera «torre di potenze» in un'espressio- 
ne finita. Ben lungi dall'essere circolare, è 
un maneggevole compendio di molte defi- 
nizioni differenti, appartenenti a una me- 
desima famiglia. 

Se questo gioco di destrezza vi lascia 
ancora un po' scettici, provate a vedere 
nella figura in alto quello che farà il ge- 
nietto Lisp se richiedete una «traccia» 
della funzione e poi chiedete ancora una 
volta di valutare (potenza 9 3). 

Sulle righe segnate «ENTERING» il 
genietto Lisp stampa i valori dei due ar- 
gomenti e sulle righe contrassegnate da 
«EXITING» stampa il valore che ha cal- 
colato. Per ogni riga ENTERING c'è 
naturalmente una riga EXITING e le due 
sono allineate verticalmente, cioè sono 
scritte con una uguale rientranza rispetto 
al margine sinistro. 

Come si vede, per trovare il valore di 
(potenza 9 3 ) il genietto deve prima calco- 
lare (potenza 9 2). Quest'ultimo, però, 
non è un dato: bisogna conoscere il valore 
di (potenza 9 1) e questo, a sua volta, 
richiede la conoscenza di (potenza 9 0). 
Questo, finalmente, c'è stato dato: è 1. 
Adesso possiamo risalire, ricordando che 
per ottenere una risposta dalla risposta 
«più profonda» dobbiamo moltiplicare 
per9. Abbiamoquindi 9, poi 81, poi 729. 

Naturalmente non siamo noi ma il ge- 
nietto che deve seguire questa via. 11 ge- 
nietto Lisp deve essere in grado di so- 
spendere un calcolo per lavorare su un 
altro la cui risposta sia stata richiesta per 
prima. E anche il secondo calcolo può 
richiedere la risposta a un terzo, e così via 
ricorsivamente. A un certo punto, però, il 
gioco si ferma - cioè si arriva a un punto in 
cui un processo si completa e restituisce 
un valore - e questo mette in grado altri 
processi che si sono accumulati di restitui- 



— > (potenza 9 3) 

ENTERING potenza (a = 9, d = 3) 
ENTERING potenza (a = 9. d = 2) 
ENTERING potenza (a = 9, d = 1) 
ENTERING potenza (a = 9, d = 0) 
EXITING potenza (valore: 1) 
EXITING potenza (valore: 9) 
EXITING potenza (valore: 81) 
EXITING potenza (valore: 729) 
729 
— > 



// genia Lixp valuta (potenza 9 3) 



re infine un valore; proprio come un 
gruppo di aereoplani che abbiano girato 
per ore e infine riescono ad atterrare, con 
ogni atterraggio che apre la strada a un 
altro atterraggio. 

Di solito, il genietto Lisp non stampa 
una traccia di ciò che sta pensando finché 
non glielo si chiede. Che glielo si chieda o 
meno, comunque, questo è quello che 
succede dietro le quinte ogni volta che 
viene valutata una richiesta di funzione. Il 
saper affrontare queste definizioni ricor- 
sive senza scomporsi è uno degli aspetti 
più positivi del Lisp. 

Non sono così ingenuo da aspettarmi 
che ora abbiate capito tutto della 
ricorsività e possiate mettervi facilmente 
a scrivere enormi programmi ricorsivi. In 
effetti, la ricorsività può essere uno 
strumento straordinariamente sottile e a 
volte anche un esperto può trovarsi in 
difficoltà a cogliere il significato di una 
complicata definizione ricorsiva. Ho 
pensato, quindi, di farvi fare un po' di 
pratica con la ricorsività. 

Facciamo un semplice esempio basato 
su questo indovinello: come si fa una pila 
di 13 pietre? Una risposta banale sareb- 
be: si mette una pietra su una pila di 12 
pietre. Suponiamo di voler costruire una 
funzione Lisp che ci dia non una pila di 
1 3 pietre ma una lista formata da 1 3 co- 
pie dell'atomo «pietra» o, in generale, da 
n copie di quell'atomo. Possiamo fonda- 
re la nostra risposta sulla risposta ricorsi- 
va, corretta anche se apparentemente 
banale, all'indovinello. La nozione gene- 
rale è quella di costruire la risposta per/i 
a partire dalla risposta per il predecesso- 
re di n. Costruire come? Usando la fun- 
zione cons che serve a costruire liste, 
ecco come. Qual è il caso embrionale? 
Cioè, per quale valore di n l'indovinello 
non presenta assolutamente alcun pro- 
blema? È facile: quando n è uguale a 0, 
la nostra lista dovrebbe essere vuota, il 
che significa che la risposta è nil. Possia- 
mo ora mettere insieme le nostre osser- 
vazioni in questo modo: 

(def mucchio-di-pietre 
(lambda (n) 
(cond ((eq n 0) nil) 

(t 
(cons 'pietra 



(mucchio-di-pietre 
(predecessore n))))))) 

Ora osserviamo il genietto mentre mette 
insieme un mucchio di pietre molto picco- 
lo (con «traccia» inserita, tanto per diver- 
tirsi). Basta osservare la figura della pagina 
seguente per vedere quello che succede. 
Abbiamo così una chiara illustrazione 
di ciò che si chiama «costruire una lista 
usando cons». Ora facciamo un'altra pro- 
va, questa volta con un vecchio cavallo di 
battaglia del Lisp e della ricorsività in 
genere. Guardate la definizione e vedete 
se riuscite a immaginare a che cosa do- 
vrebbe servire; poi continuate a leggere 
per controllare se avete visto giusto. 

(def wow 
(lambda (n) 
(cond ((eq n 0) I ) 
(t 
(times n (wow (sub I n))))))) 

Ricordate che «sub 1 » ha lo stesso signi- 
ficato di «predecessore». Così per scher- 
zo, perché non calcolate il valore di (wow 
100)? (Se stamattina avete fatto una bel- 
la colazione, potete provare a fare il cal- 
colo a mente.) 

Succede spesso che i genietti Lisp me- 
ditino ad alta voce mentre eseguono i 
desideri e mi è appena accaduto di sen- 
tirne uno mentre eseguiva il desiderio 
«(wow 100)». Il suo ragionamento era 
pressappoco così: 

«Hmm... (wow 100), eh? Bene, 100 
non è sicuramente uguale a 0, quindi pen- 
so che la risposta debba essere 100 volte 
ciò che sarebbe stata se il problema fosse 
stato (wow 99). Oh, mi sa che è una cosa 
da nulla. Vediamo, 99 è uguale a 0? No, 
non si direbbe, quindi penso che la rispo- 
sta a questo problema debba essere 99 
volte ciò che sarebbe stata se il problema 
fosse stato (wow 98). Vediamo...» 

A questo punto l'autore, avendo degli 
affari urgenti da sbrigare in banca, aveva 
abbandonato l'allegro genietto e non era 
ritornato che qualche millisecondo più 
tardi. Il genietto stava proprio finendo 
e diceva: 

«... e ora non mi rimane che moltiplica- 
re quello per 100 e avrò il mio risultato 
finale. Facile come bere un bicchiere 
d'acqua! Direi che la risposta sia 93326 - 



117 



— > (mucchio di pietre 2) 

ENTERING mucchio di pietre (n = 2) 
ENTERING mucchio di pietre (n = 1) 
ENTERING mucchio di pietre (n = 0) 
EXITING mucchio di pietre (valore: nil) 
EX1TING mucchio di pietre (valore: (pietra)) 
EXITING mucchio di pietre (valore: (pietra pietra)) 
(pietra pietra) 



// genio mette insieme un mucchietto dì pietre 



2154439441526816992388562667004- 
9071596826438162146859296389521- 
7599993229915608941463976156518- 
2862536979208272237582511852109- 
1 6864000000000000000000000000, se 
non mi sbaglio.» 

È la risposta che avevi trovato, caro 
lettore? Ah, vedo dove hai sbagliato: è 
quando hai moltiplicato per 52. Torna 
indietro e riprova da quel punto; e cerca 
di fare più attenzione quando sommi 
quelle lunghe colonne. Sono sicuro che 
questa volta troverai la risposta giusta. 

Questa funzione «wow» è chiamata di 
solito «fattoriale»; n fattoriale è 
abitualmente definito come il prodotto di 
tutti i numeri da 1 a n. Una definizione 
ricorsiva, invece, guarda le cose in modo 
leggermente differente; parlando ricorsi- 
vamente, n fattoriale è semplicemente il 
prodotto di n e del fattoriale precedente. 
Questo riduce il problema a uno più 
semplice dello stesso tipo. Quello più 
semplice sarà a sua volta ridotto, e cosi 
giù giù, fino ad arrivare al problema più 
semplice di quel tipo, che io chiamo caso 
embrionale o base. 

Un fumetto apparso qualche anno fa 
sul «New Yorker» illustra perfettamente 
il concetto. In esso si vede un uomo di 
circa 50 anni che tiene in mano una foto- 
grafia di se stesso presa circa 1 anni pri- 
ma. I n quella fotografia tiene in mano una 
fotografia di se stesso presa 1 anni prima 
di quella. E così via, finché alla fine si 
tocca il fondo (quasi alla lettera) in una 
fotografia di un robusto neonatocol sede- 
re in aria. Quest'idea delle fotografie ri- 
corsive che documentano la vostra cresci- 
ta è molto attraente e vorrei che i miei 
genitori vi avessero pensato. Fate un raf- 
fronto con il più famoso regresso all'infi- 
nito sul pacchetto del Morton Salt, in cui 
una ragazza tiene in mano una scatola di 
Morton Salt su cui è raffigurata la sua 
immagine. Poiché la ragazza dell'imma- 
gine non è più giovane dell'altra, non c'è 
nessun punto d'arrivo e il regresso è, al- 
meno teoricamente, all'infinito. 

Un'impostazione di tipo ricorsivo fun- 
ziona quando si ha una famiglia di pro- 
blemi tra loro connessi, almeno uno dei 
quali può avere una soluzione immediata. 
Questo è quello che io chiamo il caso 
embrionale. (Nell'esempio del fattoriale 
è il caso «(eq n 0)», la cui soluzione è 1.) 
Ogni problema può venir considerato 



come caso particolare di un problema 
generale («Come si calcola un fattoria- 
le?»). La ricorsi vita si basa sul fatto che le 
soluzioni a vari casi sono collegate le une 
alle altre in qualche forma logica. (Per 
esempio, io potrei dirvi molto agevolmen- 
te il valore di 100 fattoriale se solo qual- 
cuno mi passasse il valore di 99 fattoriale; 
tutto quello che ho bisogno di fare è mol- 
tiplicare per 100.) Si potrebbe dire che il 
motto di chi ricorre a procedimenti ricor- 
sivi sia: «Per Bacco! Vi risolverei questo 
caso se soltanto qualcuno mi facesse ma- 
gicamente avere la soluzione del caso che 
è di un passo più vicino al caso embriona- 
le». Ovviamente questo motto presuppo- 
ne che alcuni casi siano, in qualche senso, 
«più vicini» al caso embrionale di altri. 
Presuppone, cioè, che ci sia un cammino 
naturale che porta da un caso qualsiasi giù 
fino al caso embrionale, un cammino i cui 
passi siano chiaramente distinguibili. 

In tutte le circostanze questo è il pre- 
supposto più ragionevole. Per far emer- 
gere la vera natura di questo cammino 
guida della ricorsi vita dovete rispondere a 
due Domande Fondamentali: 

1 . Qual è il caso embrionale? 

2. Che relazione c'è tra un caso tipico e 
il caso immediatamente più semplice? 

In realtà ciascuna di queste Domande 
Fondamentali si divide in due sottodo- 
mande (come conviene a ogni domanda 
ricorsiva che si rispetti) una riguardante il 
come si riconosce dove siete e come ci si 
deve muovere e l'altra riguardante la so- 
luzione a ogni stadio dato. Allora, messe 
in termini più espliciti, le nostre Doman- 
de Fondamentali sono: 

la. Come si fa a sapere quando si è 
raggiunto il caso embrionale? 

16. Qual è la risposta embrionale? 

la. Partendo da un caso tipico, come si 
fa a compiere esattamente un passo verso 
il caso embrionale? 

26. Come si costruisce la risposta a que- 
sto caso partendo dalla risposta «magi- 
camente data» al caso più semplice? 

La domanda la riguarda la natura della 
discesa verso il caso embrionale, la base. 
La domanda 26 riguarda l'aspetto inver- 
so, vale a dire \ ascesa che vi riporta dal 
basso ai livelli superiori. 



Nel caso del fattoriale, le risposte alle 
Domande Fondamentali sono: 

\a. Il caso embrionale si ha quando 
l'argomento è 0. 

Ib. La risposta embrionale è 1. 

la. Sottrarrei dall'attuale argomento. 
26. Moltiplicare la risposta «magica» 
per l'attuale argomento. 

Si noti come le risposte a queste quattro 
domande siano tutte incorporate nella 
definizione ricorsiva di «wow». 

La ricorsività si fonda sul presupposto 
che presto o tardi si arrivi alla base. Un 
modo per essere sicuri di arrivare alla 
base è quello che tutti i passi «discenden- 
ti» muovano nella stessa direzione allo 
stesso ritmo, in modo che il percorso sia 
ovviamente lineare. Per esempio, è ovvio 
che continuando a sottrarre 1 raggiunge- 
rete alla fine 0, sempre che- siate partiti 
con un intero positivo. È altrettanto ovvio 
che applicando l'operazione «cdr» per 
l'abbreviazione di liste raggiungerete alla 
fine nil, sempre che siate partiti con una 
lista finita. Per questa ragione, sono co- 
muni i procedimenti ricorsivi che utilizza- 
no «sub 1 » o «cdr» per definire il loro 
percorso di discesa verso il basso. Presen- 
terò più avanti un percorso ricorsivo basa- 
to sull'operazione cdr, ma prima voglio 
mostrare un divertente processo ricorsivo 
numerico in cui il percorso verso il caso 
embrionale è tutt'altro che lineare. 

Consideriamo il famoso problema 
«3n+l»: si parte con un qualsiasi 
intero positivo e, se è pari, lo si dimezza, 
altrimenti lo si moltiplica per 3 e si ag- 
giunge I . Chiamiamo il risultato di questa 
operazione su n «(dotpu n)» (che sta per 
«dimezzare o triplicare più uno»). Ecco 
una definizione Lisp di dotpu: 

(def dotpu 
(lambda (n) 

(cond ((pari n) (dimezzare n)) 
(t (add I (times 3 n)))))) 

Questa definizione presuppone che altro- 
ve siano state definite o saranno definite 
altre due funzioni, cioè «pari» e «dimez- 
zare» («add 1 » e «times» sono, come ho 
già detto, parti intrinseche del Lisp). Ecco 
le definizioni mancanti: 

(def pari 
(lambda (n) (eq (remainder n 2) 0))) 

(def dimezzare (lambda (n) (quotient n 
2))) 

Cosa pensate che avvenga se iniziate con 
un intero e continuate ad applicare dot- 
pu? Prendiamo 7, per esempio, come 
punto di partenza. Prima di calcolare, 
provate a indovinare che tipo di compor- 
tamento potrebbe risultare. 

Risulta che il percorso è spesso sor- 
prendentemente caotico e accidentato. 
Per esempio, se iniziamo con 7, il proce- 
dimento ci porta a 22, poi 1 1, poi 34, 17, 
52, 26, 13, 40, 20, 10, 5. 16. 8. 4, 2, 1 ,4, 2, 



118 



1 , 4, 2, 1... Si noti che finiamo in uno 
stretto loop. Supponiamo, allora, di met- 
terci d'accordo sul fatto che se raggiun- 
giamo I, abbiamo raggiunto il fondo e 
possiamo fermarci. Si potrebbe chiedere: 
«Chi ci dice che raggiungeremo I ? È ga- 
rantito?» Effettivamente, se non avete 
mai provato, non c'è alcuna ovvia ragione 
per credere che si raggiungerà 1. (Nel 
caso di 7, vi aspettavate che succedesse?) 
La sperimentazione numerica, però, rive- 
la che il processo ha una notevole affida- 
bilità; parrebbe che, da qualsiasi punto si 
parta, dopo un po' si raggiunga sempre I . 
(Provate a partire con 27 se volete un 
vero percorso da montagne russe!) 

Sapreste scrivere una funzione ricorsi- 
va per mostrare il percorso seguito da un 
punto di partenza arbitrario «giù» fino a 
1 ? Si noti che dico «giù» a ragion veduta, 
visto che molti dei passi sono in realtà su. 
Così il percorso che parte da 3 sarebbe la 
lista «(3 10 5 16 84 2 I)». Per risolvere 
questo rompicapo bisogna che torniate 
indietro e rispondiate da soli alle due 
Domande Fondamentali della Ricorsivi- 
tà, nella loro applicazione a questo caso. 
Notate: 

(cond ((not (volete aiuto)) 
(not (leggete oltre))) 
(t (leggete oltre ))). 

prima di tutto, il caso embrionale 
1 Questo è facile. È già stato definito 
come l'arrivo a 1 e la risposta embriona- 
le, la più semplice possibile, è la lista 
«(1)», un percorso breve ma valido che 
inizia e termina con 1 . 

Poi, alcuni casi più tipici Che opera- 
zione ci porterà da 7 più vicino di un passo 
all'embrionale 1? Certamente non l'ope- 
razione «sub 1». No, per definizione è la 
funzione dotpu stessa che vi porta sempre 
«più vicino» a 1, anche quando vi porta 
su. La singolarità dell'esempio sta natu- 
ralmente in questasconcertantecaratteri- 



stica. E a proposito di 26, come costruire 
ricorsivamente una lista che documenti il 
nostro percorso ad alta oscillazione? 
Bene, il percorso di 7 si ottiene conside- 
rando il percorso più breve di (dotpu 7), 
ossia 22. Dopo tutto, 22 è un passo più 
vicino di 7 all'embrione! 

Queste risposte ci mettono in grado di 
scrivere la richiesta definizione di fun- 
zione, usando «oeso» come variabile 
prestanome, dove «oeso» è un ben noto 
acronimo per «oeso (e solo oeso)», che 
si espande ricorsivamente a «oeso (e 
solo oeso) (e solo oeso (e solo oeso))», 
e così via. 

(def percorso-a-1 
(lambda (oeso) 
(cond ((eq oeso 1) '(1)) 
(t 
(cons oeso 

(percorso-a-1 
(dotpu oeso))))))) 

Nella figura qui sotto si può vedere il 
modo in cui il genietto Lisp «pensa» 
(evidenziato inserendo l'istruzione 
«traccia»). 

Si noti l'assoluta regolarità (forma a V) 
del margine sinistro del tracciato, nono- 
stante la caoticità dei numeri in gioco. 
Non tutti i processi ricorsivi mostrano 
questa bellezza geometrica quando ven- 
gono tracciati. La ragione è che alcuni 
problemi richiedono la soluzione dipiùdi 
un sotto-problema. Per considerare un 
esempio pratico, della vita quotidiana, di 
problema di questo genere, consideriamo 
il modo in cui potreste contare tutti gli 
unicorni d'Europa. Non è certo un'impre- 
sa da poco, eppure c'è un'elegante rispo- 
sta ricorsiva. Contiamo tutti gli unicorni 
del Portogallo (il «car» d'Europa, per così 
dire), poi contiamo tutti gli unicorni delle 
altre nazioni d'Europa (il «cdr» d'Euro- 
pa, per continuare con la metafora) e infi- 
ne sommiamo i due risultati. 



— > (percorso-a-1 3) 

ENTERING percorso-a-1 (oeso = 3) 
ENTERING percorso-a-1 (oeso = 10) 
ENTERING percorso-a-1 (oeso = 5) 
ENTERING percorso-a-1 (oeso = 16) 
ENTERING percorso-a-I (oeso = 8) 
ENTERING percorso-a-1 (oeso = 4) 
ENTERING percorso-a-1 (oeso = 2) 
ENTERING percorso a-1- (oeso = 
EXITING percorso-a-1 (valore: 
EXITING percorso-a-1 (valore: 
EXITING percorso-a-1 (valore: (4 
EXITING percorso-a-1 (valore: (8 4 
EXITING percorso-a-1 (valore: (16 8 4 
EXITING percorso-a-1 (valore: (5 16 8 4 
EXITING percorso-a-1 (valore: (10 5 16 8 4 
EXITING percorso-a-1 (valore: (31051684 
(3 10 5 16 84 2 I) 



1) 


(1)) 


(2 D) 


2 1)) 


2 0) 


2 D) 


2 D) 


2 I)) 


2 1)) 



TEMI 
METAMAGICI 

I jTj al . I K . i f, K edizione italiana di 

SCIEWIHC AMERICW 

tra gli articoli di Douglas 

Hofstadter, il titolare della rubrica 

mensile «Temi metamagici» 

vi segnaliamo: 



CON QUESTO TITOLO SI PRESENTA 

UN NUOVO AUTORE DELLA 

RUBRICA (n. 152) 



INGANNI DEL PRINCIPIO DI 
INDETERMINAZIONE E PARADOSSI 
DELLA MECCANICA QUANTISTICA 

(n. 157) 



COME POSSONO I CALCOLATORI 

COMPRENDERE L'ANALOGIA, IL 

NUCLEO DEL PENSIERO UMANO? 

(n. 159) 



«NATIONAL ENQUIRER» E «THE 
SKEPTICAL INQUIRER» (n. 165) 



IL CODICE GENETICO È 

ARBITRARIO, OSSIA POTREBBE 

FUNZIONARE COSI BENE UN 

ALTRO CODICE? (n. 166) 



INSENSIBILITÀ NUMERICA: PERCHÉ 
L'IGNORANZA NUMERICA PUÒ 

ESSERE ALTRETTANTO 

PERICOLOSA DELL'IGNORANZA 

LINGUISTICA (n. 168) 



IL NOMJC: UN GIOCO ESALTANTE 

CHE ESPLORA LA RIFLESSIVITÀ 

DELLA LEGGE (n. 169) 



TAGLIO, SFOGGIO, HRUSKA, 

EVOLUZIONE DEL 

COMPORTAMENTO E ALTRI GIOCHI 

DI STRATEGIA (n. 172) 



VARIAZIONI SU UN TEMA COME 
ESSENZA DELL'IMMAGINAZIONE 

(n. 173) 



«PRESUPPOSTI RIDUTTIVI» E LORO 

EFFETTI SULLA SCRITTURA E SUL 

PENSIERO (n 174) 



ENUNCIATI SIMILI A VIRUS E 
STRUTTURE AUTOREPLICANTESI 

(n. 175) 



Come «pensa» il genio quando esegue un tracciato 



119 



Si noti come questo produca due più 
piccoli sottoproblemi, che a loro volta 
produrranno ciascuno due sottoproblemi, 
e così via. Per esempio, come si fa a conta- 
re tutti gli unicorni del Portogallo? È faci- 
le: basta sommare il numero di unicorni 
dcll'Estremadura (il «car» del Portogal- 
lo) con il numero di unicorni del resto del 
Portogallo (il «cdr» del Portogallo). E 
come si fa a contare gli unicorni dell'E- 
stremadura (per non parlare di quelli del- 
le altre regioni del Portogallo)? Con ulte- 
riori divisioni, naturalmente. Qual è, allo- 
ra, la base? Bene, le regioni possono esse- 
re divise in distretti, i distretti in chilome- 
tri quadrati, i chilometri quadrati in ettari, 
gli ettari in metri quadrati, e qui possiamo 
anche fermarci senza divisioni ulteriori. 

Anche se la cosa può sembrare piutto- 
sto ardua, per compiere un censimento 



totale non c'è davvero altro modo che 
attraversare ogni singola parte a ogni li- 
vello dell'intera struttura, per quanto 
grande essa sia. C'è una perfetta corri- 
spondenza tra questo censimento di uni- 
corni e il problema Lisp di stabilire quanti 
atomi ci siano in una lista arbitraria. 
Come possiamo scrivere una funzione 
Lisp chiamata «atomeount» che ci dia 
come risposta 15 per la strana lista se- 
guente (che chiameremo «brahma»)? 

(((ac ab cb) (ba bc ac)) 

ab 
((cb ca ba) cb (ac ab cb))) 

Un metodo, espresso ricorsivamente, è 
esattamente analogo a quello per accerta- 
re la popolazione di unicorni in Europa. 
Vedete un po' se riuscite a formularlo. 



E idea è questa. Vogliamo costruire la 
'risposta - cioè 15 - partendo dalle 
risposte a più semplici problemi di calcolo 
di atomi. Bene, è ovvio che un problema 
di calcolo di atomi più semplice di (atom- 
eount brahma) è (atomeount (car brah- 
ma)). Un altro è (atomcount(cdr brah- 
ma)). Le risposte a questi due problemi 
sono rispettivamente 7 e 8. Ora, 15 è 
chiaramente costituito dalla somma di 7 e 
8 - il che è sensato, dopo tutto, visto che il 
numero totale di atomi deve essere il 
numero del car più il numero del cdr; non 
c'è posto in cui possano nascondersi altri 
atomi. Ouesta analisi ci dà la seguente 
definizione ricorsiva, con «s» come varia- 
bile prestanome: 

(def atomeount 
(lambda (s) 



-> (atomeount brahma) 
ENTERING atomeount 

(s = (((ac ab cb) ac (ba bc ac)) ab ((cb ca ba) cb (ac ab cb)))) 
ENTERING atomeount (s = ((ac ab cb) ac (ba bc ac))) 
ENTERING atomeount (s = (ac ab cb)) 
ENTERING atomeount (s = ac) 
EXITING atomeount (valore: I) 
ENTERING atomeount (s = (ab cb)) 
ENTERING atomeount (s = ab) 
EXITING atomeount (valore: 1) 
ENTERING atomeount (s = (cb)) 
ENTERING atomeount (s = cb) 
EXITING atomeount (valore: 1) 
ENTERING atomeount (s = nil) 
EXITING atomeount (valore: 0) 
EXITING atomeount (valore: I) 
EXITING atomeount (valore: 2) 
EXITING atomeount (valore: 3) 
ENTERING atomeount (s = (ac bc ac))) 
ENTERING atomeount (s = ac) 
EXITING atomeount (valore: 1) 
ENTERING atomeount (s = ((ba bc ac)» 
ENTERING atomeount (s = (ba bc ac)) 
ENTERING atomeount (s = ba) 
EXITING atomeount (valore: 1) 
ENTERING atomeount (s = (bc ac)) 
ENTERING atomeount (s = bc) 
EXITING atomeount (valore: I) 
ENTERING atomeount (s = (ac)) 
ENTERING atomeount (s = ac) 
EXITING atomeount (valore: l) 
ENTERING atomeount (s = nil) 
EXITING atomeount (valore: 0) 
EXITINg atomeount (valore: 1) 
EXITING atomeount (valore: 2) 
EXITING atomeount (valore: 3) 
ENTERING atomeount (s = nil) 
EXITING atomeount (valore: 0) 
EXITING atomeount (valore: 3) 
EXITING atomeount (valore: 4) 
EXITING atomeount (valore: 7) 
ENTERING atomeount 

(s = (ab (cb ca ba) cb (ac ab cb)))) 
ENTERING atomeount (s = ab) 
EXITING atomeount (valore: 1) 
ENTERING atomeount 

(s = (((cb ca ba) cb (ac ab cb)))) 



ENTERING atomeount (s = ((cb ca ba) cb (ac ab cb))) 
ENTERING atomeount (s = cb ca ba)) 
ENTERING atomeount (s = cb) 
EXITING atomeount (valore: 1) 
ENTERING atomeount (s = (ca ba)) 
ENTERING atomeount (s = ca) 
EXITING atomeount (valore: I) 
ENTERING atomeount (s = (ba)) 
ENTERING atomeount (s = ba) 
EXITING atomeount (valore: 1) 
ENTERING atomeount (s = nil) 
EXITING atomeount (valore: 0) 
EXITING atomeount (valore: I) 
EXITING atomeount (valore: 2) 
EXITING atomeount (valore: 3) 
ENTERING atomeount (s = (cb (ac ab eh))) 
ENTERING atomeount (s = cb) 
EXITING atomeount (valore: I) 
ENTERING atomeount (s = ((acabeb))) 
ENTERING atomeount (s = (ac ab cb)) 
ENTERING atomeount (s = ac) 
EXITING atomeount (valore: I) 
ENTERING atomeount (s = (ab cb)) 
ENTERING atomeount (s = ab) 
EXITING atomeount (valore: 1) 
ENTERING atomeount (s = (cb)) 
ENTERING atomeount (s = cb) 
EXITING atomeount (valore: 1) 
ENTERING atomeount (s = nil) 
EXITING atomeount (valore: 0) 
EXITING atomeount (valore: I) 
EXITING atomeount (valore: 2) 
EXITING atomeount (valore: 3) 
ENTERING atomeount (s = nil) 
EXITING atomeount (valore: 0) 
EXITING atomeount (valore: 3) 
EXITING atomeount (valore: 4) 
EXITING atomeount (valore: 7) 
ENTERING atomeount (s = nil) 
EXITING atomeount (valore: 0) 
EXITING atomeount (valore: 7) 
EXITING atomeount (valore: 8) 
EXITING atomeount (valore: 15) 



-> 



La funzione Lisp «atomeount» applicata alla lista «brahma» 



120 



(plus (atomeount (car s)) 

(atomeount (cdr s))))) 

Sembra semplice, ma ci sono un paio di 
difetti. Prima di tutto, abbiamo scritto la 
parte ricorsiva della definizione, ma ab- 
biamo totalmente dimenticato l'altra 
metà, altrettanto vitale, la base. Mi ricor- 
da quel giudice del Maryland che, come 
riportava il giornale, aveva decretato che 
«un cavallo è un animale a quattro zampe 
generato da altri due cavalli». È un'otti- 
ma definizione, ma su cosa si fonda? Lo 
stesso si può dire di atomeount: qual è il 
caso più semplice, il caso embrionale, di 
atomeount? E quando ci viene richiesto di 
contare gli atomi di un singolo atomo. La 
risposta in questo caso è naturalmente I . 
Ma come facciamo a sapere di aver di 
fronteun atomo? Perfortuna.il Lisp ha in 
sé una funzione detta «atom» che ha valo- 
re t (per «true», cioè «vero») ogni volta 
che si ha un atomo e in caso contrario nil. 
Cosi «(atom 'plop')» ci dà t e «(atom "(a b 
e))» ci dà nil. Possiamo allora risistemare 
la nostra definizione: 

(def atomeount 
(lambda (s) 
(cond ((atom s) 1) 
(t 
(plus (atomeount (car s)) 

(atomeount (cdr s))))))) 

Ma non va ancora bene del tutto. Se 
richiediamo al genietto l'atomcount di 
«(a b e)», invece di 3 otterremo come 
risposta 4. Incredibile! Cosa avviene? 
Possiamo affrontare il problema cercan- 
do un esempio ancora più semplice: se 
chiediamo (atomeount '(a)), otteniamo 
2 invece di I. Ora dovrebbe essere più 
chiaro qual è l'errore: 2 = 1 + 1, dove 1 
è fornito sia dal car sia dal cdr di «(a)». 
Il car è l'atomo «a», che dovrebbe esse- 
re effettivamente calcolato 1, ma il cdr è 
nil, che non dovrebbe essere calcolato. 
Come mai, allora, nil dà un atomeount 
di 1 ? Perché nil non è soltanto una lista 
vuota ma anche un atomo! Per soppri- 
mere questo effetto negativo inseriamo 
semplicemente un'altra clausola cond in 
alto: 

(def atomeount 
(lambda (s) 
(cond ((nuli s) 0) 

((atom s) I ) 
(t 
(plus (atomeount (car s)) 

(atomeount (cdrs))))))) 

«(nuli s)» è semplicemente un altro 
modo per dire «(eq s nil)». In generale, 
quando si vuole stabilire se il valore di 
un'espressione è o non è nil, si può usa- 
re la funzione «nuli», che dà t se sì e nil 
se no. Quindi, per esempio, «(nuli (nuli 
nil)» dà come valore nil, dato che la 
funzione interna dà come valore t, e t 
non è nil! E «(nuli '(nuli nil))»? 

Ora, cosa avviene quando applichiamo 
la nostra funzione a brahma, il suo 
obiettivo originale? Nella pagina a fronte 





// rompicapo della Torre di Brahma. I 64 dischi su «a» devono essere collocali 
nello stesso ordine su «b» 



si può vedere il risultato che si ottiene. 

Si noti la più complessa topografia di 
questo processo ricorsivo, con i suoi al- 
terni spostamenti dal margine sinistro. Il 
precedente processo ricorsivo a forma di 
V sembrava una semplice discesa in un 
canyon con le pareti smussate e la suc- 
cessiva risalita; quest'ultimo, invece, ci 
fa pensare alla discesa e risalita di un 
canyon più tormentato, in cui incon- 
triamo vari «sotto-canyon» che dobbia- 
mo percorrere allo stesso modo, e chi sa 
quanti livelli di tale struttura saremo 
chiamati ad affrontare nella nostra 
esplorazione? La forma descritta da una 
struttura che procede indefinitamente 
come quella è stata chiamata «fractal» 
da Benoit Mandelbrot. 

Si noti che in questo processo ricorsi- 
vo abbiamo più di un caso embrionale 
(«nuli» e «atom») e più di un modo per 
scendere verso il caso embrionale (via 
car o via cdr). Le nostre Domande Fon- 
damentali possono essere allora un po' 
riviste: 

la. C'è un solo caso embrionale o ce 
ne sono parecchi o ce n'è addirittura una 
classe infinita? 

ìb. Come si fa a sapere quando si è 
raggiunto un caso embrionale? 

le. Quali sono le risposte ai vari casi 
embrionali? 

la. Da un caso tipico c'è esattamente 
un modo per muovere verso un caso em- 
brionale o ci sono varie possibilità? 

2b. Da un caso tipico, come stabilire 
quale prendere delle varie strade verso un 
caso embrionale? 

2c. Come costruire la risposta a questo 
caso partendo dalle risposte «magica- 
mente date» a uno o più casi più semplici? 

Uno dei più eleganti processi ricorsivi 
che conosca trae origine dal famoso 
rompicapo noto con i nomi di «Torre di 
Lucas», «Torre di Hanoi» e «Torre di 
Brahma». Inventato dal matematico 
francese Edouard Lucas nel XIX secolo, 
è legato a questa leggenda popolare: 

Nel grande tempio di Brahma a Bena- 
res, su un piatto d'ottone posto sotto la 
cupola che segna il centro del mondo, ci 
sono 64 dischi di oro puro che i sacerdoti 
spostano, uno alla volta, da uno all'altro 



di tre perni di diamante secondo l'immu- 
tabile legge di Brahma: nessun disco può 
essere posto su un disco più piccolo. All'i- 
nizio del mondo tutti e 64 i dischi forma- 
vano la Torre di Brahma su un perno. 
Ora, invece, è in svolgimento il processo 
di trasferimento della torre da un perno a 
un altro. Quando l'ultimo disco sarà infi- 
ne a posto, formando di nuovo la Torre di 
Brahma ma su un perno differente, allora 
arriverà la fine del mondo e tutto tornerà 
in polvere. 

Qui sotto si può vedere una raffigura- 
zione del rompicapo; ho indicato con «a», 
«b» e «e» i tre perni. 

Se ci pensate un po', scoprirete certa- 
mente il metodo sistematico che i sacer- 
doti devono seguire per spostare i dischi 
dal perno «a» al perno «b». Per soli tre 
dischi, per esempio, non è difficile scrive- 
re l'ordine delle mosse: 

ab ac bc ab ca cb ab 

In questo caso, l'atomo Lisp «ab» rappre- 
senta un passaggio dal perno «a» al perno 
« b». La struttura di ciò che avviene, però, 
non è rivelata da una semplice elencazio- 
ne di tali atomi. Appare meglio se si rag- 
gruppano gli atomi nel modo seguente: 

ab ac bc ab ca cb ab 

Il primo dei tre gruppi serve a trasferire 
una torre da 2 dal perno «a» al perno 
«e», liberando un disco più grosso che, 
con la mossa centrale, viene spostato dal 
perno «a» al perno «b». Il terzo gruppo 
è del tutto simile al primo, in quanto 
riporta la torre da 2 dal perno «e» al 
perno «b». Riuscire a muovere tre di- 
schi, quindi, dipende dalla capacità di 
muoverne due. Analogamente, riuscire 
a muovere 64 dischi dipende dalla capa- 
cità di muoverne 63. Vi basta? Ora cer- 
cate di scrivere una funzione Lisp che vi 
dia una soluzione alla torre di Brahma 
pern dischi. (Se preferite, potete marca- 
re i tre perni con cifre invece che con 
lettere, in modo che le mosse siano rap- 
presentate da numeri di due cifre come 
12.) Darò la soluzione il mese prossimo, 
sempre che, naturalmente, i sacerdoti 
non riescano nel frattempo, lavorando 
giorno e notte, a raggiungere l'obiettivo 
di provocare la fine del mondo. 



121